Labshake search
Citations for Addgene :
1 - 50 of 651 citations for Poly rC Binding Protein 4 PCBP4 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Chrimson.FLEX: AAV5-Syn-FLEX-rc[ChrimsonR-tdTomato] (Chrimson; Addgene) or AAV5-Ef1a-DIO.eNpHR.3.0-eYFP (NpHR ...
-
bioRxiv - Neuroscience 2022Quote: ... and ChrimsonR (pAAV5-syn-FLEX-rc[ChrimsonR-tdTomato], Addgene) were made in the anterior cingulate cortex (ACC ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAVrg-CAG-Jaws+GFP-FLEX (pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2], Addgene) for optogenetics inhibition of STN somas projecting to MLR ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Cancer Biology 2019Quote: eGFP as control or RB1 were cloned into the Rc/CMV vector (Addgene plasmid 1763). Electroporesis-based transfection protocol (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Neuroscience 2021Quote: ... a ChrimsonR-tdTomato fusion cDNA was isolated from pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (Addgene #62723) and cloned into pAAV-Ef1a-fDIO EYFP digested as above ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cyclin D3 cDNA was cloned out of Rc/CMV cyclin D3 (CMV promoter; #10912 from Addgene) with PCR using the primers listed in Table 1 and cloned into pmCherry-C1 (CMV promoter ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice were injected with one of the four viruses: rAAV1/EF1α1.1-FLPX-rc [Chronos-GFP] (Addgene plasmid #122102 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Rc-CMV-Cyclin E (#8963) and lentiviral constructs pLB (#11619) and pLKO (#8453) were purchased from Addgene. shRNA oligos for Spy1 and a scrambled control were ligated into the pLKO and pLB vectors ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-Syn-FLEX-rc [ChrimsonR-tdTomato] (FLEX-Chrimson, 1.20e+13 gc/mL, 250 nL, Addgene #62723-AAV5), AAVrg-hSyn-Cre-WPRE-hGH (retro-Cre ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Neuroscience 2022Quote: ... A group of C57BL/6J mice was injected with Chrimson.FLEX: AAV5-Syn-FLEX-rc[ChrimsonR-tdTomato] (Chrimson; Addgene) and AAV9.rTH.PI.Cre.SV40 (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Biochemistry 2022Quote: ... All expression constructs were in the form containing an N-terminal His6 and maltose-binding protein (MBP) tag (Addgene #11517).
-
bioRxiv - Immunology 2021Quote: ... a human RNH1-full coding sequence (ORIGEN RC 200082) insert was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... the human Angiogenin (ANG) full coding sequence (ORIGEN RC 208874) was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Cell Biology 2023Quote: ... polyspora Hop1319-529 into UC Berkeley Macrolab vectors to generate N-terminal TEV protease-cleavable His6- or His6-maltose binding protein tags (Addgene #29666, 29706). DNA binding mutants of S ...
-
bioRxiv - Neuroscience 2023Quote: We targeted the A2 region of the cNTS by making a small incision in the meninges over the foramen magnum and injected 500 nL of pAAV5-Syn-FLEX-rc[ChrimsonR-tdTomato] (Addgene # 62723) at a depth of 0.5 mm ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Neuroscience 2022Quote: ... Following AAVs were used: AAVrg-CAG-FLEX-rc[Jaws-KGC-GFP-ER2] (titer >7×1012 vg/ml, viral prep #84445-AAVrg, Addgene, US,34) or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FOP flash (mutated TCF binding sites; Addgene#12457) luciferase expression vectors and with Renilla luciferase vector (control ...
-
bioRxiv - Cell Biology 2023Quote: ... or MRE plasmid with mutated TCF binding sites (Addgene, 12457), together with 100 ng of the Renilla luciferase control plasmid (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormon poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormon poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormon poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormon poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormone poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Genetics 2022Quote: The SpCas9-EGFP-bGH poly(A) cassette from Addgene plasmid #61408 was cloned into the pStart-K vector (Addgene #20346) ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... the promoter of the established TEAD binding reporter (8xGTIIC)(18) (Addgene, 34615) was fused into a construct containing destabilized GFP (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNA binding sequence (AAGAGGTACGTACAGGTACT) was inserted into the vector pDD162 (from Addgene) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all TF binding site and mKate sequences were derived from SPECS plasmids (Addgene #127842). The NFAT response element was subcloned from the pSIRV-NFAT-eGFP plasmid68 (a gift from Peter Steinberger ...
-
bioRxiv - Genomics 2021Quote: ... Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). PUF9R-tethered iRFP670 and mRuby2 were created by a combination of PCR (from IDT gBlocks ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reporter constructs contained 14 UAS sites for Gal4-DBD binding (source: Addgene 128010), an enhancer and a core promoter ...
-
bioRxiv - Genomics 2024Quote: Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). Cloning of dCas9 expression plasmid (lenti-dCas9-Blast ...
-
bioRxiv - Immunology 2022Quote: The poly(A) sequence was cloned into pRosa26-promoter vector (Addgene: 21710) by BamHI-HF and XbaI ...
-
bioRxiv - Cancer Biology 2023Quote: ... The bGH poly(A) signal was PCR amplified from pX459 (Addgene, 62988) using primers forward ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (wt p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442). The DNA polymerase used was Phusion High Fidelity (cat# E0553S ...
-
bioRxiv - Molecular Biology 2021Quote: We performed a genome-wide CRISPR knock-out (KO) screen using the lentiviral Brie sgRNA library comprising 4 sgRNAs per protein-coding gene (Addgene #73632) (Doench et al. ...
-
bioRxiv - Genetics 2023Quote: ... and a poly-A p-3’entry clone (Addgene, Kristen Kwan, Chien lab) were used.
-
bioRxiv - Biochemistry 2021Quote: URA7 and URA8 wild type genes with ribosomal binding site were cloned into pet28b-6His (Addgene, Massachusetts ...
-
bioRxiv - Plant Biology 2024Quote: ... Acceptors were pOdd1-4 (pCk1-4, Addgene plasmids # 136695-136698) for Level 1 and 3 and pEven1-4 (pCsA-E ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... EF.deltaBHES1.Ubc.GFP (DBD-HES1 DNA-binding domain mutant of HES1; #24982) were obtained from Addgene (Cambridge, USA). The reporter plasmids containing the firefly luciferase gene under the control of various fragments of the Hes1 promoter (2.5 kb ...