Labshake search
Citations for Addgene :
1 - 50 of 981 citations for PCR Product Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... a gfp PCR product was PCR amplified from pPD95.75 (Addgene) using primers containing 35bp of overlap with the spop-1 gene immediately upstream of the predicted nuclear localization sequence ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product and pCS2-FLAG (AddGene 16331) were digested with EcoRI and XhoI and ligated with T4 DNA Ligase ...
-
bioRxiv - Cell Biology 2022Quote: ... A PCR product of ColX (from Addgene #110726) and a synthetic gene containing PAUF (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products were cloned into pRAV23 (Addgene) using EcoRI and HindIII restriction sites and transformed into Top10 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... a PCR product of myc-BirA* (35700; Addgene) was ligated into XhoI and SpeI cleaved pCAG-mNCad-HA ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR products were ligated into lentiCRISPR v2 (Addgene, 52961) using Gibson Assembly® Master Mix (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: A PCR product from plasmid pDD282 (Addgene plasmid # 66823) was used as a donor template for insertion of gfp ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were subcloned into the pUC19 plasmid (Addgene) and sequenced.
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into the pPD95.77 vector (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR product was then subcloned into pcDNA3.1+ (Addgene) using BamHI and NotI restriction endonucleases (pcDNA3.1+-KanSacB).
-
bioRxiv - Developmental Biology 2021Quote: Kaede PCR product was amplified from the plasmid (Addgene #54726) for generating the template for capped mRNA synthesis (primers F ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR product was placed in pME (pDONR221 #398, Addgene) using a Gateway recombination reaction with BP clonase II ...
-
bioRxiv - Developmental Biology 2023Quote: ... an amplified PCR product from pCAG-TAG (Addgene, Plasmid #26771) was cloned into the KpnI-NotI sites of pcDNA3.1-H2B mCherry-poly(A83 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR products were cloned into the pMAL-c2x (Addgene # 75286) vector ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were cloned into pNIC-CH (Addgene plasmid 26117) by ligation-independent cloning (42) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cloned the PCR products into overexpression vectors EGFP-N1 (Addgene) or pLenti6 (Addgene) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR product was cloned into the pENTR4 no ccDB plasmid (Addgene #17424 ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR products and a pCS2+8 vector (Gokirmak et al., 2012) (Addgene) were digested with XbaI and BamHI (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ...
-
bioRxiv - Immunology 2023Quote: ... The wzm – wbbO PCR product was assembled with PCR-linearized pBBR1MCS2 plasmid (Addgene, primers pBBR1-1F/pBBR1-1R) using an NEBuilder HiFi DNA Assembly kit (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the ~350 bp PCR product was cloned directionally into pFRB-NLUC (Addgene) cut with the BamH1 and BsiW ...
-
bioRxiv - Cell Biology 2020Quote: ... Other gene deletions were generated using PCR products derived from pFA6a-kanMX6 (Addgene 39296) or pFA6a-hphNT1 (Euroscarf P30347 ...
-
bioRxiv - Cancer Biology 2019Quote: ... by PCR and subcloning the product into the pENTR1A-GFP-N2 vector (Addgene # 9364) at the HindIII and BamH1 restriction sites ...
-
bioRxiv - Plant Biology 2021Quote: ... Gel-purified PCR product and SspI-digested pET-His6-MBP-TEV-LIC vector (Addgene) were treated with T4 DNA polymerase with 25 mM dCTP and dGTP for 30 min at 22°C followed by heat inactivation ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was subcloned into pJFRC19-13XLexAOP-IVS-myr::GFP vector (Addgene#26224) to generate pJFRC19-13XLexAOP-yki3S/A ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA templates for PCR products were as follows - myo-3p from pCFJ104 (Addgene #19328), pgl-1::GFP::FLAG from DUP75 (Andralojc et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... The corresponding PCR product was subsequently cloned into linearised tdTOMATO-C1 plasmid (Addgene #54653), before transfected into ECs by electroporation.
-
bioRxiv - Biochemistry 2023Quote: ... Then PCR products were Gibson-cloned into the PEmax mRNA plasmid (Addgene plasmid #204472) digested with RsrII and XhoI enzymes ...
-
bioRxiv - Molecular Biology 2021Quote: ... This plasmid was used as a template for PCR and 2500ng of purified HDR template PCR product combined with 1500ng of guide RNA expression plasmid (Addgene 49330) containing the guide RNA listed in Table S4 were co-transfected into OSCs ...
-
bioRxiv - Neuroscience 2021Quote: ... TOPO-cloned the PCR products into pENTR-D-TOPO and transferred to pBPGUw (Addgene #17575) using standard Gateway cloning ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR products were then inserted in the pJFRC4-3XUAS-IVS-mCD8::GFP (Addgene 28243) linearized by NotI ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were cloned into the BsmBI-digested lentiviral vector LRG2.1 (Addgene plasmid # 108098) using a Gibson Assembly® Cloning Kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were subsequently cloned pExpTol2-UAS-E1B-ReaChR-TS-tagRFP-cryaa-mCherry (Addgene #43963) digested with SpeI and PacI using Hi-Fi DNA Assembly.
-
bioRxiv - Cell Biology 2023Quote: PCR products from plasmids GFP-AHPH-WT (a gift from Michael Glotzer, Addgene plasmid # 68026) and GFP-AHPH-DM (a gift from Alpha Yap ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were cloned into the doxycycline-inducible plasmid pCW57-MCS1-2A-MCS2 (Addgene #71782), which was modified by adding bGHpolyA between the MluI and BamHI restriction sites ...
-
bioRxiv - Cell Biology 2022Quote: ... we Gibson assembled a PCR product containing CMV-StrepKDEL-IRES-SBP (amplified from Addgene plasmid #65295) to the SalI/MluI digested piggyback backbone (a generous gift from Jonathon Nixon-Abell ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product contained arms of homology to the acceptor plasmid (SM-KDM5B-MS2; Addgene #81084). The acceptor plasmid was cut with NheI (New England BioLabs ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product contained arms of homology to the acceptor plasmid (SM-KDM5B-MS2 Addgene #81084). The acceptor plasmid was cut with NotI (New England BioLabs ...
-
bioRxiv - Genetics 2020Quote: ... The BamHI/ XhoI digested NCL PCR product was cloned into BamHI/ XhoI digested pGPD2 (Addgene; #43972). The NCL-ΔRGG plasmid was similarly created using primers NCL-For and NCLΔRGG-1XHA Rev (Table S1) ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The amplified PCR products were ligated to the NotI and SalI linearized MSCV vector (RRID: Addgene_17442). The MSCV murine ADAR2E396A expression construct was generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... strain MB921 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-Cterm-pFA6a-GFP/paGFP-F and Cut7-Cterm-pFA6a-GFP/paGFP-R ...
-
bioRxiv - Cell Biology 2022Quote: ... strain MB1147 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-988-Cterm-pFA6a-GFP-F (TTAAAGGGAACGACATCACTTGCTAATCATACTAATGAATTACTTGGTTTAG-GAGATGAACGGATCCCCGGGTTAATTAA ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were subsequently cloned into pExpTol2-UAS-E1B-ReaChR-TS-tagRFP-cryaa-mCherry (Addgene #43963) digested with SpeI and PacI using Hi-Fi DNA Assembly.
-
bioRxiv - Neuroscience 2023Quote: ... Both PCR products were assembled with the Tol2 Gateway plasmid backbone (pDestTol2pA2-U6:gRNA; Addgene #63157) using Hi-Fi DNA Assembly to obtain elavl3:hArr-TEV;he1.1:YFP.
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was digested with KpnI and XhoI and integrated into pSH1.6EGFP (Plasmid #42323, Addgene). The Flot1 gene was amplified from genomic DNA from YT16 rice using the primers HindIII_OsFlot1Prom1-F1 and Eco47III_OsFlot-R1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Physiology 2023Quote: ... The PCR product was cloned via AgeI/BamHI into an MCS-BioID2-HA plasmid (Addgene #74224)15 to enable expression of an NCLX-BioID2-HA fusion protein under the control of a CMV promoter ...