Labshake search
Citations for Addgene :
1 - 36 of 36 citations for PARP1 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Flag-PARP1 was obtained from Addgene (#111575).
-
bioRxiv - Cancer Biology 2020Quote: Flag-tagged PAPR1 WT (PARP1-Flag; #111575) was purchased from Addgene. The Flag-tagged PARP1 R138C mutant was generated by the site-directed mutagenesis Kit (Agilent ...
-
bioRxiv - Biophysics 2022Quote: ... PARP1 and PARP2 sgRNAs were inserted into the px330 plasmid (Addgene # 42230) as previously described (Cong et al. ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- CCACCTCAACGTCAGGGTGC) was cloned into LentiCRISPRv2 vector (Addgene, 52961). Lentivirus carrying CRISPR/Cas9-PARP1 guide was transduced to HCT116 in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- AAACATGTAGCCTGTCTGGA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... separated by a P2A self-cleaving peptide (Addgene ID NK676).
-
bioRxiv - Molecular Biology 2024Quote: ... # 48076) and a transit peptide (in plasmid pICH78133; Addgene # 50292) to target the biosensor to the nuclei and chloroplast stroma respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... the signal peptide (0-26 amino acids) of pro-opiomelanocortin (#176704, Addgene) and ectodomain (52-750 amino acids ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... The SunTag (24 x GCN4 peptides) was PCR amplified from the plasmid pcDNA4TO-24xGCN4_v4_sfGFP (Addgene #61058) (Tanenbaum et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... Plasmid pN_35S/CTP-mCitrine was produced in an earlier study [41] and encodes an mCitrine fluorescent protein fused in-frame to the chloroplast transit peptide from RuBisCO small subunit 1A (www.addgene.org, plasmid #117989 (RRID:Addgene_117989)) ...
-
bioRxiv - Plant Biology 2020Quote: ... the Hip1 sequence was amplified without signal peptide and cloned into the pET28a (+) expression vector (Addgene, USA), eventually having a His-tag at the N-terminus ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sequences described above were cloned in frame with the signal peptide NLS (in plasmid pICH86988; Addgene (www.addgene.org) # 48076 ...
-
bioRxiv - Biochemistry 2020Quote: ... and substrate domain (i.e., WMEDYDYVHLQG, a peptide derived from p130cas)—from its parent plasmid (a Kras-Src FRET biosensor, Addgene), (ii ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmid was created by adding the rtTA with a 2A peptide to the Puromycin resistance gene in a CMV Puro DEST plasmid (Addgene) by gibson cloning41 ...
-
bioRxiv - Cell Biology 2021Quote: ... Source of different elements are as follows: LAMP1 signal peptide and human LAMP1 were PCR amplified from LAMP1-mGFP (Addgene Plasmid #34831 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified and cloned red shifted Luc gene downstream of MNDU3 promoter and linked via 2A peptide to florescent protein encoding gene which were amplified from Addgene plasmids 48249 (mWasabi) ...
-
bioRxiv - Immunology 2021Quote: ... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Molecular Biology 2022Quote: ... WT SpCas9 flanked by two nuclear localization signals linked to a blasticidin-S-deaminase – mTagBFP fusion protein via a self-cleaving peptide (derived from lenti-dCAS9-VP64_Blast, a gift from Feng Zhang, Addgene #61425). Following blasticidin selection ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing its endogenous intron were fused upstream of 2A self-cleaving peptide and eGFP and cloned into an MSCV vector (PIG, Addgene) [100] ...
-
bioRxiv - Molecular Biology 2023Quote: For pseudotyping rVSV-ΔG*RenLuc with rabies spike protein the residues 1 - 485 including the ecto- and transmembrane domains but excluding the cytoplasmic tail of RABV-G (ERA strain, UniProtKB ID: P03524.1, residue numbering includes signal peptide) were cloned into pEBB vector (Addgene #22226), resulting in plasmid pEBB-R0CT ...
-
bioRxiv - Biophysics 2019Quote: ... ZapA-LPETG was incubated with 0.5 mM of labelled peptide GGGC-Cy5 and 10μM Sortase 7M (purified using pET30b-7M SrtA, a gift from Hidde Ploegh, Addgene plasmid #51141) in a final concentration of 50 μM ...
-
bioRxiv - Plant Biology 2021Quote: ... vector was modified to tie resistance marker gene expression directly to Cas9-Nlux expression by the P2A peptide linker to generate the plasmid pNOC-ARS-CRISPR-P2A-BlastR (Addgene: 98147). The P2A-BlastR fragment was amplified from pNOC-ARS-destiny-P2A-BlastR-GFP (Poliner et al. ...
-
bioRxiv - Bioengineering 2020Quote: ... The ScFv library with the N-terminal CD8α signal peptide was fused to the synNotch-Gal4VP64 receptor backbone (Addgene plasmid #79125) in place of the CD19-specific scFv ...
-
bioRxiv - Immunology 2019Quote: ... The PresentER plasmid encoding a signal peptide from Mouse Mammary Tumor Virus envelope protein followed by the SIINFEKL epitope followed by mCherry was obtained from Addgene (#102945),a kind gift of D ...
-
bioRxiv - Synthetic Biology 2020Quote: The Sav library was created based on a previously described expression plasmid that contains a T7-tagged Sav gene with an N-terminal ompA signal peptide for export to the periplasm under control of the T7 promoter in a pET30b vector (Addgene #138589)34 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Cell Biology 2023Quote: A synthetic sequence corresponding to 2A peptide from Thoseaasigna virus capsid protein and BspTI (AflII) restriction site was first cloned to pCXLE-EGFP (Plasmid #27082, Addgene, www.addgene.org) (Okita et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... The AAV capsid AAV1-X1 was built by inserting a 7-mer peptide between AAs 588-589 of the AAV1 cap gene in AAV1-Rep-Cap (Challis et al. 2019) (Addgene 112862).
-
bioRxiv - Biochemistry 2022Quote: Plasmids encoding the full-length spike proteins with native signal peptides were cloned into the background of the HDM-SARS2-Spike-delta21 plasmid (Addgene Plasmid #155130). This construct contains a 21 amino acid c-terminal deletion to promote viral expression ...
-
bioRxiv - Immunology 2022Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Biochemistry 2023Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Plant Biology 2024Quote: ... together with a fragment containing the nucleotides encoding for the Pip1 pro-domain but lacking the signal peptide (pJK110; Supplemental Table S4) were combined in all 64 possible combinations with pICH41264 (Addgene #4799; Weber et al., 2011) in a BpiI Golden Gate reaction (Supplemental Table S4) ...
-
bioRxiv - Developmental Biology 2020Quote: ... sgRNA sequences targeting the N-terminal region of the predicted small peptides were inserted into pSpCas9(BB)-2A-GFP (Addgene plasmid #48138, gift from Feng Zhang) via its BpiI cloning sites ...