Labshake search
Citations for Addgene :
1 - 50 of 457 citations for Native Red Fluorescent Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... a monomeric red fluorescent protein (RFP)-FKBP12 (Addgene, Plasmid #67514) (71 ...
-
bioRxiv - Cell Biology 2019Quote: ... RCC1 was targeted with an infra-red fluorescent protein (IFP2.0 Addgene #54785), TIR1 was targeted with 9 Myc-tag sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Genetics 2019Quote: ... mCherry fluorescent protein marker (Addgene), and ampicillin resistance gene ...
-
bioRxiv - Microbiology 2021Quote: Mycobacterium marinum (ATCC 927) with the pTEC27 plasmid expressing the red fluorescent protein tdTomato (Addgene #30182, http://n2t.net/addgene:30182) (29 ...
-
bioRxiv - Cell Biology 2019Quote: ... The nuclear red fluorescent protein (RFP)-expressing lentiviral construct (LV-RFP) was a gift from Elaine Fuchs (Addgene plasmid # 26001). To infect lentiviruses ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected AAVPHP.eB (1012 vg/ml) encoding a red fluorescent protein fused to an opsin (pAAV-TRE3G-BiPOLES-mKate2 (Addgene # 192579)) to label the membrane of cFos+ neurons ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470; inhibition: AAV1-CAG-tdTomato, Addgene #59462). Viral injection volume was scaled by age with 200nL injected at P9 ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pBAD expressing fluorescent protein variants (Addgene, UK). Primers used in the assembly of the vectors are listed in SI Table 1.
-
bioRxiv - Biophysics 2022Quote: Fluorescent proteins were obtained from Addgene (https://www.addgene.org/) transfected using 0.2 ug plasmid DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... dopamine was recorded with a red fluorescent GRABDA sensor (AddGene #140557AAV9-hSyn-GRAB rDA1h), while VTA DA terminals in the NAcc were stimulated for the approximate duration of the offer cue (500-600 ms) ...
-
bioRxiv - Molecular Biology 2023Quote: The MCS of pBAD24 (Guzman et al., 1995) was exchanged for the red fluorescent protein (RFP) cassette from pPGC-C (Addgene plasmid # 174580,(Bentham et al., 2021)) flanked by BsaI restriction sites ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
bioRxiv - Immunology 2020Quote: Plasmids containing fluorescent protein coding sequences mCerulean3-N1 (Addgene # 54730), mAzurite-N1 (Addgene # 54617) ...
-
bioRxiv - Biochemistry 2021Quote: ... or N-terminal His6 plus green fluorescent protein (GFP; RRID:Addgene_29716). Note that in the plasmid names for this clone the numbering of Syx residues was based on the Syx isoform from NCBI Reference Sequence NP_001036128.1 ...
-
bioRxiv - Genetics 2020Quote: ... and a blue fluorescent protein (BFP) expression cassette (Addgene #36086). The 1kb upstream and 1kb downstream arms were amplified from purified mouse genome from AB2.2 ES cells (ATCC #SCRC-1023 ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: Plasmids encoding fluorescent fusion protein were either purchased from Addgene or constructed in house using ligation (NEB Cat# M2200S ...
-
bioRxiv - Cell Biology 2023Quote: ... and enhanced green fluorescent protein (eGFP) (Addgene, Boston, MA, USA). Cells were nucleofected using the Amaxa 4D-Nucleofector (Lonza ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Molecular Biology 2022Quote: For validation experiments we introduced the fluorescent protein EBFP2 (source: Addgene 54665) driven by the dpse enhancer and the CG13116 promoter in the RD-seq plasmid backbone to be able to gate for transfected cells in flow cytometry (Suppl ...
-
bioRxiv - Neuroscience 2024Quote: Enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1) was commercially purchased (Addgene). The fluorescent protein mKate was inserted into a pcDNA3.1(- ...
-
bioRxiv - Plant Biology 2019Quote: ... Green fluorescent protein (GFP) from the Gateway entry vector pENTR4-GFP-C1 (Addgene) was transferred to pYES-DEST52 and pAG426GAL-ccdb using Gateway LR Clonase ...
-
bioRxiv - Neuroscience 2020Quote: ... Retrograde adeno associated viruses encoding green fluorescent protein (Addgene, Catalog number 50465-AAVrg) or tdtomato (Addgene ...
-
bioRxiv - Physiology 2021Quote: ... Fluorescent protein sequences were PCR-derived from pmVenus(L68V)-mTurquiose2 (Addgene plasmid #60493), Gamillus/pcDNA3 (Addgene plasmid #124837) ...
-
bioRxiv - Systems Biology 2023Quote: ... and to amplify the fluorescent proteins from plasmids (SYFP2 from pSYFP2-C1 Addgene #22878 ...
-
bioRxiv - Cancer Biology 2024Quote: Pre-Intact clone was infected with pLV-Azurite (blue fluorescent protein, Addgene, 36086) and Pre-ARSIR1 clone was infected with SGEP-Renilla-713 (GFP ...
-
bioRxiv - Biochemistry 2022Quote: Plasmids encoding the full-length spike proteins with native signal peptides were cloned into the background of the HDM-SARS2-Spike-delta21 plasmid (Addgene Plasmid #155130). This construct contains a 21 amino acid c-terminal deletion to promote viral expression ...
-
bioRxiv - Immunology 2022Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Biochemistry 2023Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Neuroscience 2019Quote: ... The intracellular solution also contained 50 µM of the red fluorescent dye AlexaFluo 594 and 3 plasmids with the following concentrations42: 100µg/µL pCAG-dsRed2 (Addgene #15777), 200 µg/µL pCMV-oG48 (Addgene 74288 ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... A plasmid expressing Green Fluorescent Protein (GFP) (pLJM1-EGFP was a gift from David Sabatini (Addgene plasmid # 19319 ...
-
bioRxiv - Cancer Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell lines were transiently transfected with a membrane-targeted fluorescent protein (glycosylphosphatidylinositol-anchored eGFP, Addgene #32601) using a TransIT-X2 transfection kit (Mirus) ...
-
bioRxiv - Biochemistry 2021Quote: The ORAI1-yellow fluorescent protein (YFP) construct was purchased from Addgene (Cambridge, MA, USA; plasmid no. 19756). Site directed mutagenesis using the Pfu Turbo DNA polymerase from Agilent Technologies (Santa Clara ...
-
bioRxiv - Neuroscience 2021Quote: ... retrograde AAV expressing enhanced blue fluorescent protein (EBFP) and Cre recombinase (AAVrg-pmSyn1-EBFP-cre, Addgene #51507) was injected into either NAc or RSC of Rosa26TdTomatoAi9 ...
-
bioRxiv - Microbiology 2022Quote: ... 1µg of lentiviral vector bearing green fluorescent protein (GFP) (PLV-eGFP) (gift from Pantelis Tsoulfas, Addgene plasmid # 36083) 90 using Jetprime transfection reagent (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: ... Of the following vectors the fluorescent protein was exchanged for Tq-Ca-FLITS: 3xnls-mTurquoise2 (Addgene plasmid #98817) for a nuclear tag ...
-
bioRxiv - Cell Biology 2019Quote: ... replacing the mCherry coding sequence in pFA6a-mCherry:Hph with the coding sequence for the photo-switchable fluorescent protein mEOS3.2 (5) (Addgene) by standard restriction-digestion cloning (using restriction enzymes BamHI and AscI ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ; http://n2t.net/addgene:167585 ; RRID:Addgene_167585).