Labshake search
Citations for Addgene :
1 - 50 of 1648 citations for Mouse Two pore calcium channel protein 2 Tpcn2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... We expressed mammalian cDNAs encoding calcium-channel e37a-Cacna1b (Addgene: 26569) and e37b-Cacna1b (Addgene ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA) to drive expression preferentially in principal neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA). Virus (0.5 µl ...
-
bioRxiv - Neuroscience 2023Quote: The calcium indicator GCaMP6s (Addgene 40753, MA) (32 ...
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Neuroscience 2020Quote: ... Optogenetic and calcium imaging plasmids were obtained from Addgene (ChRoME15 ...
-
bioRxiv - Neuroscience 2023Quote: ... Expression of the calcium indicator GCaMP7f (Addgene, AAV1.Syn.GCaMP7f.WPRE.SV40) was achieved by stereotaxic injection of AAV virus ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we performed two-step cloning using a Platinum Gate TALEN kit (Addgene, #1000000043). In the assembly-step 1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... a solution containing two sgRNAs (40 ng/μL each) and Cas9 protein (250 ng/μL) (Addgene; 47327) (Gagnon et al. ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... carrying the fluorescent calcium indicator GCaMP6f (AAV.Syn.Flex.GCaMP6f.WPRE.SV40, 1E13 particles/ml, Addgene) into the left VTA (AP ...
-
bioRxiv - Bioengineering 2022Quote: ... for calcium imaging or pAAV-Syn-Archon1-KGC-GFP-ER2 (Addgene) for voltage imaging ...
-
bioRxiv - Cancer Biology 2022Quote: ... Calcium phosphate transfection was used to generate EGFR-G719C (Addgene 116254), EGFR-L858R (Addgene 11012) ...
-
bioRxiv - Neuroscience 2023Quote: ... an AAV encoding the calcium indicator GCaMP6s (AAV2-hSyn-GCaMP6s; Addgene) was injected.
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... with two px458 (Addgene, 48138) plasmids containing gRNA sequences targeting the deletion breakpoints ...
-
bioRxiv - Neuroscience 2022Quote: ... to express two fluorescent proteins with different colors in presynaptic areas (AAV2-retro-GFP and pAAV2-retro-tdTomato, Addgene # 59462). The aim was to test whether the labeled presynaptic circuits would differ substantially if the injection location was slightly jittered ...
-
bioRxiv - Immunology 2023Quote: ... Calcium reporter jGCaMP7s sequence was amplified from pGP-CMV-jGCaMP7s (104463, Addgene) and cloned into pBOB plasmid by LIC ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...
-
bioRxiv - Cell Biology 2020Quote: Two previously described sgRNAs specific to the Kap1 gene10 (Supplementary Table 2) were incorporated into plentiGuide-puro vector (Addgene #52963). For production of lentiviral particles ...
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Biochemistry 2024Quote: ... expressing Cas9 nuclease and two gRNAs (see below for sequences) together with the CRIS-PITCh vector pX330S-2-PITCh (63670, Addgene), harboring the Lamin A microhomologies and GFP-Puro or GFP-Neo/Kan insertions ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Cancer Biology 2023Quote: ... 377 million iCas9-expressing NIH-3T3 cells were transduced with the Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Wang et al, 2017) (Addgene; 1000000096) using spinfection at an MOI of 0.3 to ensure a final library coverage of 500X ...
-
bioRxiv - Neuroscience 2023Quote: ... The two helper AAVs from Addgene were diluted in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40) (Addgene, titer ≥ 1×10¹³ vg/mL) were mixed in a 1:1 ratio and vortexed immediately prior to intracranial infusion surgeries.
-
bioRxiv - Neuroscience 2023Quote: ... Calcium imaging experiments were performed with AAV1-Syn-FLEX-jGCaMP7f (Addgene 104492-AAV1) for M1CT neurons or AAVretro-hSyn-FLEX-jGCaMP7f (Addgene 104492-AAVrg ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Neuroscience 2020Quote: We employed a two-step Golden Gate assembly method using the Platinum Gate TALEN Kit (Addgene; cat#1000000043) to construct Platinum TALEN plasmids containing the homodimer-type FokI nuclease domain ...
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... two packaging plasmids (Addgene #8454 and 8455). 50,000 HEK293T were transduced with a MOI of 10 of each lentivirus in a 24-well format and then selected for blasticidin expression (5 μg/ml ...
-
bioRxiv - Biochemistry 2019Quote: ... Two previously described plasmids pSADuet259 (Addgene #121910) and pSABAD250 (Addgene #45612 ...
-
bioRxiv - Plant Biology 2020Quote: ... two gBlocks and four plasmids from Addgene, pICH47742::2x35S-5′UTR-hCas9 (STOP)-NOST (Addgene no ...
-
bioRxiv - Neuroscience 2024Quote: ... two plasmid constructs pmGFP10C-Tau (Addgene, #71433) and pmGFP11C-Tau (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus was generated in 293T cells by calcium phosphate cotransfection with psPAX2 (Addgene #12260), pCMV-VSV-g (Addgene #8454) ...
-
bioRxiv - Neuroscience 2022Quote: ... a calcium indicator AAV9-hSyn-GCAmp6f-eYFP (Addgene, viral titer 2.8 × 1013 vg/mL) or a control virus AAV9-hSyn-eYFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: Calcium indicator GCaMP6f (AAV1-Synapsin-GCaMP6f-WPRE-SV40, Addgene 100837-AAV1; 6.52 ×1012GC/ml) was injected using the same procedure at 4.5-5 months after injection of AAV-GFAP-htTau or AAV-GFAP-Control ...
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...