Labshake search
Citations for Addgene :
1 - 50 of 1154 citations for Mouse Putative Phospholipase B Like 2 PLBD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 virus-like particles were prepared as previously described (68) by co-transfecting plasmids for N (Addgene 177937); M and E (Addgene 177938) ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus small ubiquitin-like modifier (SUMO; RRID:Addgene_29711); or N-terminal His6 plus green fluorescent protein (GFP ...
-
bioRxiv - Developmental Biology 2024Quote: ... The putative enhancer regions were cloned into the pE1b-GFP-Tol2-Gateway vector (Addgene, plasmid # 37846) [38] ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Biophysics 2021Quote: ... The gp67-438-B modified from 438-B (Addgene) was used to express recombinant secretory proteins.
-
bioRxiv - Developmental Biology 2019Quote: Four gRNAs targeting loci on both sides of the C-terminal region of Rok containing the putative phosphorylation sites to be mutated were cloned into pCFD3 vector (Addgene 49410) following the protocol from (Port et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... we generated guide RNAs targeting a site close to the putative translation start site and cloned into the pX330 vector using BbsI (Addgene 42230), as summarized in Table S3 ...
-
bioRxiv - Neuroscience 2023Quote: ... we utilized PiggyBac integration technology to express PB-tet-NGN2 (Addgene 172115; “cortical-like” neurons) and PB-tet-hNIL (Addgene 172113 ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Genomics 2021Quote: ... shRNA-specific plasmid together with lentiviral packaging plasmids like VSVG (a gift from Bob Weinberg, Addgene #8454), and PAX2 ...
-
bioRxiv - Genomics 2021Quote: ... These cells were co-transfected with lentiviral packaging plasmids like VSVG (a gift from Bob Weinberg, Addgene #8454) and PAX2 (a gift from Didier Trono ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or ddGFP-B (Addgene, 40287). cDNAs for the PAR binding domains were amplified from previously published pET19b constructs (Gibson et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509 ...
-
bioRxiv - Immunology 2024Quote: ... and B (AUC = 0.61, Addgene) respectively (Fig S10i) ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Microbiology 2020Quote: All virus-like particles were generated in HEK293T cells via calcium phosphate transfection using packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted into a pcDNA3.1-Hygro(-)-like with a C-terminal HRV 3C cut site and human Fc tag amplified from Addgene plasmid 145164 using standard cloning techniques ...
-
bioRxiv - Cancer Biology 2023Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cell Biology 2019Quote: The Polo-like binding domain (PBD) of PLK1 (amino acid 326 to amino acid 603) was amplified from the pTK24 plasmid (Addgene) and cloned into a pT7-His6-SUMO expression vector using NEB Gibson assembly (Gibson Assembly Master Mix ...
-
bioRxiv - Immunology 2022Quote: ... lentivirus-like particles were made by transfecting HEK293T cells with the plasmids psPAX2 (gift from Didier Trono, Addgene plasmid # 12260), pMD2.G (gift from Didier Trono ...
-
bioRxiv - Bioengineering 2023Quote: A DNA sequence encoding the CD47 Ig-like domain (Gln19 – Ser135) was cloned into the pCTCON2 yeast-surface display vector (Addgene) using the NheI and BamHI sites ...
-
bioRxiv - Genetics 2023Quote: ... following the manufacturer’s protocol with AAVS1 targeting vector and predesigned transcription activator-like effector nucleases (hAAVS1 TALEN Left and Right were gifts from Su-Chun Zhang, Addgene plasmid # 52341 & 52342 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Microbiology 2022Quote: The SARS CoV-2 papain-like protease (PLpro) domain of Nsp3 was cloned from a doxycycline-inducible piggyBac transposon vector (PB-TAC-ERP2, Addgene# 80478) containing the synthesized full-length Nsp3 from the Wuhan-Hu-1 SARS CoV 2 strain (Alvarez and Yao ...
-
bioRxiv - Neuroscience 2019Quote: ... PMCA2w/b and GCamP6s (both from Addgene); and DsRedExpress2 (Clontech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HiFi SpCas9 (#) HypaR-SpCas9 (Addgene #126757), B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Cell Biology 2023Quote: ... and pUC57-b-globin (Addgene plasmid 194437) have been deposited at Addgene.
-
bioRxiv - Microbiology 2023Quote: ... and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFPC1-hVAP-B KD/MD (Addgene – 104450), pEFIRES-P-mTagBFP-KDEL (Addgene – 87163 ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ...
-
bioRxiv - Bioengineering 2021Quote: ... and B-GECO was also obtained from Addgene. MaLionG and mitoMaLionR were generated in the author’s group (T ...
-
bioRxiv - Bioengineering 2022Quote: Assembloids were formed with VTA- and PFC-like spheroids such that one spheroid type was transduced with AAV9-GCaMP6f (Addgene, cat# 100836-AAV9) while the other was transduced with either an inhibitory or excitatory DREADDs virus (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... expression plasmid was cloned by PCR amplification from full length ScTop2 12URA-B vector followed by insertion into a modified 1-B (Addgene #29653) E ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and pSH-EFIRES-B-Seipin-miniIAA7-mEGFP (Addgene #129719) [3,10] ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-GfaABC1D-mCherry-hPMCA2w/b plasmid was ordered from Addgene.
-
bioRxiv - Cancer Biology 2024Quote: ... and p73C proteins were subcloned into pET15-b (Addgene, #24866), pET28-a ...
-
bioRxiv - Immunology 2022Quote: ... for Alpha-S and pcDNA3.3-SARS2-B.1.617.2 (Addgene, no.172320) for Delta-S proteins ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid vector pHSP70-Cas9 (donated by L. B. Voshall, Addgene #45945) (Gratz et al. ...