Labshake search
Citations for Addgene :
1 - 50 of 746 citations for Mouse Mitogen Activated Protein Kinase Kinase Kinase MLT MLTK ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...
-
bioRxiv - Physiology 2023Quote: FLAG-IKK2 kinase inactive K44M (IKK2DN, Addgene, #15466) was cloned into pLenti-CMV-Puro DEST vector (Addgene ...
-
bioRxiv - Biochemistry 2019Quote: ... sapiens Pyk2 kinase domain expression vector PTK2BA encoding H6-TEV-kinase [414-692] was a gift from Nicola Burgess-Brown (Addgene # 42401). Cloning vector pET-H6-SUMO-TEV-LIC (1S ...
-
bioRxiv - Molecular Biology 2022Quote: ... or pRK5-MYC-mTOR kinase-dead (Addgene plasmid #8482)) using the TransIT-X2 transfection reagent (Mirus ...
-
bioRxiv - Cancer Biology 2023Quote: A human kinase domain-focused gRNA library (Addgene 117725) [25] was used to assess CRISPR Cas9 screening as a tool in breast cancer PDTO to identify whether novel vulnerabilities could be detected for each PDTO ...
-
bioRxiv - Cancer Biology 2022Quote: ... and constitutively kinase-active (#64608) IKKα were purchased from Addgene. Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA) to drive expression preferentially in principal neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA). Virus (0.5 µl ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-Snf1 kinase domain (Snf1-KD) expression vector was purchased from Addgene (#52683). Those DNA constructs were transformed in Rosetta2 (Novagen ...
-
bioRxiv - Cell Biology 2022Quote: Full-length ERK3 wild type (WT) pDONR-223 construct purified from Human Kinase Library (Addgene) was used as a template to generate ERK3 K49A K50A kinase dead (KD ...
-
bioRxiv - Cell Biology 2023Quote: ... we expressed the ULK1 kinase from a pCAG backbone encoding MBP-TSF-TEV-ULK1 (RRID:Addgene_171416). The transfection and expression procedure was similar to what is described above for NAP1 ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA fragments containing MAP3K1 (MEKK1) or kinase-dead MAP3K1 were excised from pCDNA-MEKK1 plasmids (Addgene #12181 and #12180 ...
-
bioRxiv - Genetics 2023Quote: ... fused to the herpes simplex virus thymidine kinase-encoding gene (HSV-TK) from the pFA6a-HyTkAX vector (Addgene plasmid # 73898; http://n2t.net/addgene:73898; RRID:Addgene_73898) [80] ...
-
bioRxiv - Microbiology 2024Quote: ... Wild-type Myc-MEKK3 (in pcDNA3.1 vector) was generated from a kinase-dead mutant (K391A, Addgene plasmid # 44157)(55 ...
-
bioRxiv - Biochemistry 2019Quote: ... and a mammalian expression vector pcDNA3 encoding hemagglutinin tagged constitutively active glycogen synthase kinase-3β (GSK-3β) (S9A) (pcDNA3-GSK3β, # 14754, RRID: Addgene_14754). The EGFP in pRK5 vector was first replaced by iRFP to construct an iRFP tagged WT tau by golden gate assembly (pRK5-iRFP-tau ...
-
bioRxiv - Cell Biology 2021Quote: ... CHO cell lines were transfected with a reporter construct containing three copies of the PPRE placed upstream of the thymidine kinase promoter-firefly luciferase fusion gene (PPRE X3-TK-luc, Addgene). In addition ...
-
bioRxiv - Developmental Biology 2019Quote: Two gRNAs targeting loci near the start codon of the Rho kinase gene were cloned into pCFD3 vector (Addgene 49410) following the protocol from (Port et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Select MOC1 clones that show lack of protein expression of RIP3 were transduced with inducible lentiviral vectors encoding WT (Plasmid #73701) or kinase-dead mutant (D143N) RIP3 (Plasmid #73703) purchased from Addgene (These plasmids were gifted by Dr ...
-
bioRxiv - Genetics 2023Quote: ... we first deleted the ORF with a cassette containing the hygromycin resistance marker (hphRMX) fused to the herpes simplex virus thymidine kinase-encoding gene (HSV-TK) from the pFA6a-HyTkAX vector (Addgene plasmid # 73898 ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant WNK1 kinase domain was eluted via addition of 50 nM bdSENDP1 protease (Frey et al., 2014; Addgene ID 104962) in wash buffer 4.
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tag5Amyc-GSK3β S9A (constitutively active GSK3β, plasmid #16261), and Tag5Amyc-GSK3β K85A (Kinase dead GSK3β, plasmid #16262) were from Addgene (Watertown, MA). Cyclin D3 cDNA was cloned out of Rc/CMV cyclin D3 (CMV promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... Lentiviral expression vector encoding the p38 MAPK Kinase Translocation Reporter (KTR) was a kind gift from Markus Covert (Addgene plasmid no. 59155). ON-TARGETplus SMARTpool siRNAs for the genes of interest as well non-targeting negative control siRNAs were obtained from Dharmacon (Lafayette ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligos were phosphorylated in vitro with T4 polynucleotide kinase (#M0201S) from New England Biolabs (Ipswich, MA, USA) and ligated into pDR274 vector (#42250) from Addgene (Watertown, MA, USA), which was previously linearized with BsaI (#R0535 ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Genomics 2023Quote: To generate a functional mouse sgRNA pooled library of the pAP210 and pAP215 plasmids, we transferred the sgRNA sequences from the mCRISPRi-v2 M1 (Kinases, Phosphatases, and Drug Targets) gRNA pooled library (Addgene pooled library #83989)10 ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Neuroscience 2022Quote: ... Addgene) designer receptors exclusively activated by designer drugs (DREADD) or control (pAAV8-hSyn-EGFP; Addgene) were delivered into the dLS as described for GCaMP7 (see 2.4.1 ...
-
bioRxiv - Pathology 2021Quote: The constitutively activated STAT3 plasmids (STAT3-C Flag pRc/CMV) were purchased from Addgene (Plasmid #8722). C2C12 cells were transiently transfected with STAT3-C plasmids using the Lipofectamine™ 2000 Transfection Reagent according to the manufacturer’s instructions (Life Technology ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The KrasG12D mutation was then activated by transient transfection of Salk-Cre with pPGK-Puro (Addgene#11349) plasmids ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Immunology 2019Quote: ... The PresentER plasmid encoding a signal peptide from Mouse Mammary Tumor Virus envelope protein followed by the SIINFEKL epitope followed by mCherry was obtained from Addgene (#102945),a kind gift of D ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 million cells per replicate were activated and 12-20 h later electroporated with the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene 48138) expressing the Myc sgRNA using the MaxCyte STx transfection system (MaxCyte) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Enhanced serotype inhibitory Designer Receptors Exclusively Activated by Designer Drugs (DREADD) vectors used were AAV-PHP.eB-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362, ME) (Chan et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single clones were obtained by fluorescence-activated cell sorting and functionally tested for Cas9 activity using a lentiviral reporter pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W (Addgene #67980). PPM1D-mutant cell lines were generated using the RNP-based CRISPR/Cas9 delivery method using a single sgRNA (GCTAAAGCCCTGACTTTA) ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated with Protein A/G-MNase fusion protein (Addgene, Cat #123461) at 700 ng/mL for 1 hour at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...