Labshake search
Citations for Addgene :
1 - 50 of 2724 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... RAW 264.7 macrophages were transduced with lentiviral particles containing Gal-9-3xFLAG expressed from pLenti-puro (Addgene #39481). Primary murine bone marrow-derived macrophages (BMMs ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp12 protein was expressed from pFastBac vector 438C (Addgene #154759) in Hi5 insect cells ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Microbiology 2022Quote: ... we also expressed WT and D614 S-protein-FLAG (Addgene plasmids 156420 and 156421 ...
-
bioRxiv - Biochemistry 2024Quote: Biotinylated proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Biochemistry 2020Quote: ... Membrane scaffold protein 1D1 (MSP1D1) was expressed from the pMSP1D1 plasmid (AddGene) with an N-terminal His-tag and was purified by affinity chromatography (26).
-
bioRxiv - Molecular Biology 2019Quote: ... The nanodisc scaffold protein MSP1D1 was expressed and purified using pMSP1D1 (Addgene #20061) as described previously (Denisov et al. ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Microbiology 2020Quote: ... expressed from Addgene plasmid # 62988 (PX459) ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Biochemistry 2022Quote: ... Immobilized proteins were eluted by incubation with 1 mL of 250 nM SENPEuB protease (expressed and purified from pAV286 (Addgene # 149333))74 overnight at 4° C ...
-
bioRxiv - Neuroscience 2022Quote: ... This construct was generated from a plasmid that contained a wild-type (WT) rat Nfasc gene expressed from the cytomegalovirus (CMV) promoter (a gift from Vann Bennett, Addgene plasmid # 31061 ...
-
bioRxiv - Cancer Biology 2019Quote: ... expressed from a pLKO.1-hygro plasmid backbone (Addgene #24150). Three days after lentiviral transduction ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Microbiology 2022Quote: ... HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid # 12263). The protease mutations D25N and R57G were generated by overlapping PCR using pCMV ΔR8.2 as a template ...
-
bioRxiv - Biophysics 2019Quote: ... both proteins were expressed in HEK293T cells using a modified pTT5 expression vector (Addgene no. 44006), purified using StrepTactin beads (GE ...
-
bioRxiv - Genomics 2022Quote: ... Protein A-MNase was expressed and purified from BL21(DE) carrying pET-pA-MN (Addgene: 86973).68–70
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified and cloned red shifted Luc gene downstream of MNDU3 promoter and linked via 2A peptide to florescent protein encoding gene which were amplified from Addgene plasmids 48249 (mWasabi) ...
-
bioRxiv - Genetics 2020Quote: The mouse Erk1 gene gRNA (GGTAGAGGAAGTAGCAGATG) and mouse Erk2 gene gRNA (GGTTCTTTGACAGTAGGTC and CTTAGGGTTCTTTGACAGT) were cloned into pX330 vector obtained from Addgene. The target vector and pEF1a-pac vector were co-transfected (5:1 ratio ...
-
bioRxiv - Biochemistry 2023Quote: ... as described in Janecek et al.39 Aurora B protein was expressed from plasmid pNIC28-AurB (Addgene 39119).
-
bioRxiv - Cancer Biology 2022Quote: ... the mouse Snai1 gene was amplified from pTK-Snai1 plasmid (#36976, Addgene) using primers (forward ...
-
bioRxiv - Neuroscience 2020Quote: ... to label hyaluronic acid-based ECM we designed AAV expression vector carrying link protein hyaluronan and proteoglycan link protein 1 (HAPLN1, Gene ID: 12950) fused with mScarlet subcloned from the plasmid pCytERM_mScarlet_N1 (Addgene plasmid # 85066). Clones were verified by sequencing analysis and used for the production of adeno-associated particles as described previously (Mitlöhner et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The negative transcriptional feedback circuit used for the experiment contained a transcriptional repressor protein TetR expressed under a self-repressible promoter (Addgene plasmid # 45774; http://n2t.net/addgene:45774; RRID:Addgene 45774). TetR was fused to the green fluorescent protein variant deGFP and measured using excitation and emission at wavelengths 485 nm and 525 nm ...
-
bioRxiv - Cancer Biology 2020Quote: ... which will be available through Addgene: (1) SpCas9 sgRNAs expressed using LRG2.1 (Addgene, 108098), (2 ...
-
bioRxiv - Cell Biology 2021Quote: Rhodopsin protein was expressed in HEK293 cells using transient transfection (pcDNA3 rod opsin construct, a gift from Robert Lucas (Addgene plasmid # 109361 ...
-
bioRxiv - Biochemistry 2021Quote: ... and all described mutants were independently cloned and expressed as a 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). These were cloned utilizing primers in Table S3 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The negative transcriptional feedback circuit used for the experiment contained a transcriptional repressor protein TetR expressed under a self-repressible promoter (Addgene plasmid # 45774 ...
-
bioRxiv - Genetics 2020Quote: Cas9 recombinant protein was expressed in Escherichia coli BL21 (DE3) from plasmid pMJ915 (a gift from Jennifer Doudna; Addgene # 69090) and purified as previously described (34) ...
-
bioRxiv - Genomics 2023Quote: ... pmCherry was a 4.7kb plasmid that expressed mCherry fluorescent protein under the control of a CMV promoter (Addgene, Cat# 632524). L1 plasmids consisted of pUBC-L1SM-UBC-EGFP and pMut2-UBC-L1SM-UBC-EGFP ...
-
bioRxiv - Biochemistry 2023Quote: ... the C162A mutant and the C162L mutant were independently cloned and expressed as 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). BL21 (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: OsKAI2 and the OsKAI2int mutant were independently cloned and expressed as GST (Glutathione-S-Transferase) fusion protein from the expression vector pCOOL (Addgene). BL21 (DE3 ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Biophysics 2022Quote: ... Macrophages were transfected with mEmerald-Lifeact (Addgene, #54148) to label F-actin using the Neon electroporation system ...
-
bioRxiv - Molecular Biology 2023Quote: The CRISPaint gene tagging kit was a gift from Veit Hornung (Addgene kit # 1000000086). To generate a targeting construct for AGO2 ...
-
bioRxiv - Cell Biology 2021Quote: The truncated mouse Fzd2 gene (Fzd2-delN) was cloned from pRK5-mFzd2 (#42254, Addgene) with a 1D4 tag at the C terminus by PCR using the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... An AAV that only expressed the mCherry protein under the same neuronal promoter was use as control condition (Addgene Plasmid #114472). Wildtype and Cdr1as-KO neurons were infected at DIV4-6 by directly adding the viral particles into the culturing media at a titer of 109 VG/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... The constitutively expressed retroviral vector pBABE-puro (Addgene; plasmid 1764 ...
-
bioRxiv - Biophysics 2019Quote: ... an N-terminal LCTPSR FGE recognition motif on Cas1 was inserted by site-directed mutagenesis in plasmid pWUR871 with primers in Table S1 and co-expressed with FGE proteins (Addgene, plasmid #16132) (Carrico et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Ezrin-GFP was expressed from plasmid pHJ421 (Addgene #20680) (Hao et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... and co-expressed it with CAG::Cre (Addgene: #13775) plasmid wt/wt = 30:1 for in utero electroporation ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM TCEP) and digested with SUMO protease overnight (expressed and purified in-house from Addgene plasmid pCDB30243). The cleaved protein was dialyzed against Buffer D (25 mM HEPES ...
-
bioRxiv - Biophysics 2022Quote: RNA polymerase core was expressed from plasmid pIA900 (Addgene #104401) 32 and purified according to an established protocol 32 with the exception that the Mono Q® ion-exchange purification step was exchanged with a size exclusion chromatography step using a Superose6 10/300 GL column (GE Healthcare ...
-
bioRxiv - Synthetic Biology 2022Quote: All constructs were expressed in the pJL1 plasmid (Addgene 69496). A CAT enhancer sequence (MEKKI ...
-
bioRxiv - Molecular Biology 2023Quote: ... expressed in the pCRISPRi-v2 expression vector (Addgene, Cat#84832). Plasmid sublibraries were separately packaged in HEK 293T Lenti-X cells and transduced into the CRISPRi dual color reporter line at an MOI < 1 where the percentage of transduced cells by BFP expression after 2 days post-transduction was 20%-30% ...
-
bioRxiv - Biochemistry 2022Quote: ... Addgene #149336)74 was biotinylated using BirA (expressed from pTP264, Addgene #149334)74 and further purified using a Superdex 200 16/60 gel filtration column (Cytiva ...