Labshake search
Citations for Addgene :
1 - 50 of 1754 citations for Mouse Lymphoid Enhancer Binding Factor 1 LEF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
bioRxiv - Cancer Biology 2021Quote: A promoter and enhancer element upstream of mouse Fabp4 (from Addgene #8858) was cloned into pAAV-iCre-WPRE (Vector Biosystems ...
-
bioRxiv - Genomics 2023Quote: pBabe-puro LEF1 (the long isoform) was a gift from Joan Massague (Addgene plasmid # 27023 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2018) by replacing the ubi63E enhancer with the zfh1 enhancer (from pGL3_zfh1_CP-candidate_luc+; Addgene 86391) in between the KpnI (Thermo ...
-
bioRxiv - Neuroscience 2023Quote: ... the W3SL enhancer sequence was amplified from Addgene Plasmid #61463 with a 5’ XhoI site addition and subcloned into EcoRI and KpnI sites of Addgene Plasmid #61591 to replace bGHpA ...
-
bioRxiv - Genomics 2022Quote: ... for enhancer screening or CMV-Enh-Luc (Addgene #45968) for NREs screening (All tested sequences included in Supplemental Table 1) ...
-
bioRxiv - Genomics 2023Quote: pBabe-puro LEF1 (the long isoform) was a gift from Joan Massague (Addgene plasmid # 27023; http://n2t.net/addgene:27023; RRID:Addgene_27023). Retroviruses were produced by transiently transfecting HEK293T cells with a mixture of pBabe/pBabe-LEF1 and pCL-ampho plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV expressing GCaMP6f under the control of the GABAergic neuron-specific enhancer of the mouse Dlx (mDlx) gene (Addgene# 83899-AAV1) (124) ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Cell Biology 2019Quote: Reporters of enhancer activity were constructed by cloning mCerulean3 (Addgene #54730) into the multiple cloning site of Open Biosystems vector PB533A-2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the Wnt-sensitive TOPFlash enhancer (PTCF/LEF) were purchased from Addgene (#89573 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PT enhancer-tTA2 viruses were packaged as PHP.eB with vector from Addgene (#163480). Human READR and Reporter viruses were packaged as AAV2-Retro serotype ...
-
bioRxiv - Molecular Biology 2019Quote: In vivo enhancer testing was performed with the Stagia3 reporter vector (Addgene #28177)48 ...
-
bioRxiv - Developmental Biology 2020Quote: ... VT enhancers were transferred from pCR8/GW/TOPO into pBPZpGal4DBDUw (Addgene clone 26233) using LR clonase technology (Invitrogen Gateway LR Clonase II Enzyme Mix - Catalog Number 11791-020).
-
bioRxiv - Immunology 2023Quote: ... Enhancer libraries were cloned into the lentiMPRA pLS-SceI vector (Addgene, Plasmid #137725) through Gibson assembly (E5510S ...
-
bioRxiv - Neuroscience 2020Quote: ... the promoter was substituted by mDlx enhancer sequence from pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900) and cDNA encoding mCherry was further inserted into multicloning site 21 ...
-
bioRxiv - Neuroscience 2023Quote: ... virus expressing tdTomato under the PVIN specific S5E2 enhancer (AAV9-S5E2-tdTomato, Addgene 135630-AAV9) was injected in mice using coordinates ...
-
bioRxiv - Developmental Biology 2023Quote: ... The enhancer was transferred into the destination vector pBPGAL4.2::VP16Uw (ref.60; Addgene, # 26228; RRID:Addgene_26228) via an LR clonase reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... The enhancer was transferred into the destination vector pBPGAL4.2::VP16Uw (ref.60; Addgene, # 26228; RRID:Addgene_26228) via an LR clonase reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The dpse enhancer and the CG13116 promoter were amplified from pAGW-dpse-GAL4-DBD (Addgene 125153) with primers including overhangs for Gibson cloning (Suppl ...
-
bioRxiv - Neuroscience 2022Quote: [3] ie1: An enhancer/promoter from pGL3-IE1 (a gift from Zach Adelman, Addgene ID #52894) (Anderson et al. ...
-
bioRxiv - Immunology 2023Quote: ... Each of four sgRNA sequences targeting the same enhancer was cloned into LentiCRISPRv2GFP (Addgene, Plasmid # 82416), LentiCRISPRv2-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CD68 promoter and enhancer (hCD68, ∼800 bp) was subcloned from pcDNA3-hCD68prm (Addgene #34837). The mouse F4/80 promoter (mF4/80 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The putative enhancer regions were cloned into the pE1b-GFP-Tol2-Gateway vector (Addgene, plasmid # 37846) [38] ...
-
bioRxiv - Cancer Biology 2020Quote: Multiple gRNAs per enhancer region were designed with CRISPR-SURF39 and cloned into lentiGUIDE-puro (Addgene #52963). All gRNA sequences are provided in Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2020Quote: The alrm-QF2 line was generated by subcloning the enhancer region into pPTQF#7-hsp70 (Addgene# 46136) using EcoRI and BamHI ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The LexA_ER_B112 transcription factor was amplified from Addgene_58437 (FRP880_PACT1(−1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FOP flash (mutated TCF binding sites; Addgene#12457) luciferase expression vectors and with Renilla luciferase vector (control ...
-
bioRxiv - Molecular Biology 2019Quote: The reporter construct (traffic jam enhancer driven GFP_P2A-Blasticidin-resistance harboring 10 intronic boxB sites and 14 upstream UAS sites; plasmid submitted to Addgene) was integrated into chromosomal location chr2L:9,094,918 ...
-
bioRxiv - Neuroscience 2021Quote: ... and inserted a strong CAG promoter (CMV immediate early enhancer/modified chicken β-actin promoter, from Addgene Plasmid #1378) in front of the FLEX-cassette to create pRMCE-CAG-Flex ...
-
bioRxiv - Neuroscience 2020Quote: ... The R58H05-AD and R46C03-DBD lines were generated by subcloning their respective enhancer regions into pBPp65ADZpUw (Addgene# 26234) or pBPZpGAL4DBDUw (Addgene# 26233) ...
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Molecular Biology 2020Quote: ... At least two independent sets of oligonucleotide pairs for gene knockdown of human MTs and the transcription factor MTF-1 (supplementary table S4) were synthesized and cloned into the pLKO.1-TCR vector (Addgene, Cambridge, MA, USA); the same vector was also used as an empty vector control ...
-
bioRxiv - Cell Biology 2023Quote: ... or MRE plasmid with mutated TCF binding sites (Addgene, 12457), together with 100 ng of the Renilla luciferase control plasmid (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... These primers amplify both candidate enhancers and previously assigned degenerate barcodes and add homology arms to the ORI vector (Addgene 99296)25 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Guide RNA sequences (Nes enhancer deletion-TTTGCGGTCTGAAAAGGATT, AGAATCGGCCTCCCTCTCCG, Nes null lines - GGAGCTCAATCGACGCCTGG, GCACAGGAGACCCTACTAAA) were annealed and ligated into px330 (Addgene, #42230) after digestion with BbsI (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... The CMV promoter and enhancer sequence to drive CAAX-mCherry expression was amplified from pLenti-CMV-Puro-DEST plasmid (Addgene, 17452). The two fragments were then assembled into one using overlapping PCR and inserted into LV 1-5 using the GMAP method ...
-
bioRxiv - Neuroscience 2020Quote: ... Additional viral constructs were assembled for Cre-dependent expression of a reporter under the control of the Dlx5/6 enhancer: AAV-Dlx-Flex-GFP (Addgene #83900) and AAV-Dlx-Flex-ChR2-mCherry (Dimidschstein et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lenti-vectors expressing each pair of gRNAs targeting distal enhancers were packaged in 293T cells using pMD2.G (Addgene # 12259) and psPAX (Addgene # 12260) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Synthetic enhancers were amplified by PCR with primers that included homology to the plasmid vector E1b-GFP-Tol2 (Addgene plasmid #37845)81 and were cloned upstream of the minimal promoter (E1b ...
-
bioRxiv - Cell Biology 2024Quote: ... The hDLXI56i enhancer was originally obtained from CN1851-rAAV-hI56i-minBglobin-iCre-4×2C-WPRE3-BGHpA (Graybuck et al., 2021) (Addgene #164450).
-
bioRxiv - Cancer Biology 2024Quote: ... The promoter- or enhancer-targeting sgRNAs and non-targeting sgRNAs with no genome recognition sites were cloned into LentiGuide-Puro (Addgene: 52963). The cells stably expressing dCas9-KRAB-MeCP2 were infected with these vectors and then selected with puromycin (2 ug/ml ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...