Labshake search
Citations for Addgene :
1 - 50 of 1885 citations for Mouse IgG2b Isotype Control Antibody Biotin A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-shGFP control (Addgene, cat#30323); pLKO.1-shATR (TCRN0000039615 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Biophysics 2023Quote: ... biotin ligase (BirA; Addgene#109424) was expressed in E ...
-
bioRxiv - Cancer Biology 2024Quote: ... or an empty backbone pLKO.1 control (Addgene plasmid #8453) were used to generate virus and infect OVCAR3 cells or ID8 cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... or negative control annealed oligo was inserted into pLKO.1 (Addgene) (Stewart et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1 shGFP control was obtained from Addgene (cat#30323). Wildtype IDH1 with overexpression plasmid 3X HA tag was generated by Twist Bioscience (pTwist Lenti SFFV Puro) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene). For sgRNA experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... bacterial biotin ligase BirA-ER from Addgene #20856 was subcloned into a CFP-P2A expressing shuttle vector to form f(syn)CFP-P2A-BirA-ER ...
-
bioRxiv - Neuroscience 2021Quote: ... or control virus (AAV8-hsyn-DIO-mCherry) (1×1013 VG/ml; Addgene, 50459) into 3 NBM/SI sites (350 nl/site ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control vectors pGIPZ (Dharmacon) or pLKO.1 (a gift from David Sabatini, Addgene plasmid #1864 ...
-
bioRxiv - Cell Biology 2024Quote: ... or pLKO.1-Neo-CMV-tGFP-Scramble shRNA plasmid (Addgene#136035 as scramble control). Lentiviral vectors were packaged using packaging plasmid (pCMV delta R8.2 dvpr ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene Plasmid #17920).
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA-GFP control (Addgene, #30323).
-
bioRxiv - Systems Biology 2022Quote: ... or GFP control (Addgene #89684). All transfections were performed with Lipofectamine 3000 per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Renilla luciferase control plasmid (Addgene plasmid 12179 ...
-
bioRxiv - Immunology 2022Quote: Class-switched VRC07 constructs were generated from human isotype backbone plasmids obtained from Addgene. The different human heavy chain constant regions were PCR amplified from the Addgene plasmids and inserted into the previously described AAV transfer vector 11 encoding the VRC07 heavy chain variable region and VRC07 kappa light chain ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV expressing GCaMP6f under the control of the GABAergic neuron-specific enhancer of the mouse Dlx (mDlx) gene (Addgene# 83899-AAV1) (124) ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... Control animals were injected with a control virus (pAAV-CMV-PI-eGFP-WPRE-bGH; Addgene; #105530). For both experiments ...
-
bioRxiv - Systems Biology 2023Quote: ... The control was Eahy926 cells transfected with a control plasmid (a gift from David Sabatini (Addgene plasmid #1864 ...
-
bioRxiv - Cell Biology 2020Quote: The lentiviral Control-PEROXO (Addgene #139059) and HA-PEROXO constructs (Addgene #139054 ...
-
bioRxiv - Systems Biology 2021Quote: ... additional control plasmids (PA-NL, Addgene #113445 ...
-
bioRxiv - Biochemistry 2021Quote: ... and negative control plasmids (Addgene #31122), were freshly transformed into electrocompetent E ...
-
bioRxiv - Genomics 2022Quote: ... and a scrambled control (Addgene 1864). In parallel ...
-
bioRxiv - Systems Biology 2023Quote: ... additional control plasmids (PA-NL, Addgene #113445 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pSNAPf-H2B control plasmid (Addgene #101124 ...
-
bioRxiv - Neuroscience 2023Quote: ... and an mCherry control vector (Addgene; pAAV5-CaMKIIa-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-CKIIa-mCherry (control, Addgene, injected titer of 2.3×10^13 parts/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-CAG-GFP (control, Addgene, injected titer of 1.3×10^13 parts/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... scrambled shRNA control (Addgene plasmid #1864), or an empty backbone pLKO.1 control (Addgene plasmid #8453 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected with the pLenti-PGK-Tacc3 or pLKO.1 TRC (control, Addgene 10879), pMD2G (Addgene 12259 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The expression of Biotin ligase BirA from pTP264 (Addgene #149334) was carried out as described before (Pleiner et al. ...
-
bioRxiv - Biophysics 2023Quote: ... coli biotin ligase BirA from the T7 promoter (Addgene#109424) in E ...
-
bioRxiv - Cell Biology 2020Quote: ... pWC223 encoding the motor domain of Drosophila kinesin 1 fused to BCCP (noted Kin1-biotin) was a gift from Jeff Gelles (Addgene plasmid # 15960 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sequences of the control and ZEB1 shRNA were as follows: shRNA control (shCT) (Addgene sequence #1864):
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were injected with one of two control viruses: AAV9-hSyn-DIO-mCherry (AddGene Plasmid #50459), virus titer 2.17 x 1013 or AAV9-hSyn.HI.eGFP-Cre-WPRE-SV40 ...
-
bioRxiv - Cell Biology 2020Quote: ... shRNA for LacZ (negative control) and MYC were generate according to the pLKO.1 protocol from Addgene. Cignal 45-pathway reporter arrays ...
-
bioRxiv - Neuroscience 2022Quote: ... versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459; titer: 9 × 1012 gc/ml). To ablate PVNOT neurons ...
-
bioRxiv - Cancer Biology 2023Quote: ... and EGFP control (See Supplemental Table 1 for sgRNA sequences for each)) into lentiCRISPR v2 (Addgene #52961). For individual gene knockouts pooled libraries of up to four sgRNAs were generated ...
-
bioRxiv - Biochemistry 2022Quote: The control pLKO.1-LUC shRNA vector and the pLKO.1-FLCN lentiviral shRNA vector were obtained respectively from Addgene (Plasmid #30324) and the RNAi Consortium (TRCN0000237886) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Developmental Biology 2023Quote: ... Topbp1 (shTopbp1 #1 and shTopbp1 #2) and a scramble control sequence (shScbl) were cloned into the pLKO.1-Hygro lentiviral vector (Addgene plasmid #24150). The lentiviral-containing medium was harvested from HEK293T cells at 48 h and 72 h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... and control plasmid p-WPXL (Addgene, #12257) were used for Sox9 overexpression and the transfection was performed by using FuGENE6 Transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Copia Renilla Control plasmid (#38093; Addgene) (Lum et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... cells were transfected with control (pcDNA3.1, Addgene) or pcDNA3.1-Myc-eIF4A1 (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... Mitochondrial matrix APEX2 control vector (Addgene #72480) was also subcloned into pBABE-Puro ...