Labshake search
Citations for Addgene :
1 - 50 of 599 citations for Mouse IgG2a Isotype Control Antibody Biotin 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and IgG2a Fc (Addgene #114492), were amplified and extracted similarly ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Biophysics 2023Quote: ... biotin ligase (BirA; Addgene#109424) was expressed in E ...
-
bioRxiv - Neuroscience 2020Quote: ... bacterial biotin ligase BirA-ER from Addgene #20856 was subcloned into a CFP-P2A expressing shuttle vector to form f(syn)CFP-P2A-BirA-ER ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA-GFP control (Addgene, #30323).
-
bioRxiv - Systems Biology 2022Quote: ... or GFP control (Addgene #89684). All transfections were performed with Lipofectamine 3000 per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Renilla luciferase control plasmid (Addgene plasmid 12179 ...
-
bioRxiv - Immunology 2022Quote: Class-switched VRC07 constructs were generated from human isotype backbone plasmids obtained from Addgene. The different human heavy chain constant regions were PCR amplified from the Addgene plasmids and inserted into the previously described AAV transfer vector 11 encoding the VRC07 heavy chain variable region and VRC07 kappa light chain ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV expressing GCaMP6f under the control of the GABAergic neuron-specific enhancer of the mouse Dlx (mDlx) gene (Addgene# 83899-AAV1) (124) ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... Control animals were injected with a control virus (pAAV-CMV-PI-eGFP-WPRE-bGH; Addgene; #105530). For both experiments ...
-
bioRxiv - Systems Biology 2023Quote: ... The control was Eahy926 cells transfected with a control plasmid (a gift from David Sabatini (Addgene plasmid #1864 ...
-
bioRxiv - Cell Biology 2020Quote: The lentiviral Control-PEROXO (Addgene #139059) and HA-PEROXO constructs (Addgene #139054 ...
-
bioRxiv - Systems Biology 2021Quote: ... additional control plasmids (PA-NL, Addgene #113445 ...
-
bioRxiv - Biochemistry 2021Quote: ... and negative control plasmids (Addgene #31122), were freshly transformed into electrocompetent E ...
-
bioRxiv - Genomics 2022Quote: ... and a scrambled control (Addgene 1864). In parallel ...
-
bioRxiv - Systems Biology 2023Quote: ... additional control plasmids (PA-NL, Addgene #113445 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pSNAPf-H2B control plasmid (Addgene #101124 ...
-
bioRxiv - Neuroscience 2023Quote: ... and an mCherry control vector (Addgene; pAAV5-CaMKIIa-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-CKIIa-mCherry (control, Addgene, injected titer of 2.3×10^13 parts/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-CAG-GFP (control, Addgene, injected titer of 1.3×10^13 parts/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... scrambled shRNA control (Addgene plasmid #1864), or an empty backbone pLKO.1 control (Addgene plasmid #8453 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The expression of Biotin ligase BirA from pTP264 (Addgene #149334) was carried out as described before (Pleiner et al. ...
-
bioRxiv - Biophysics 2023Quote: ... coli biotin ligase BirA from the T7 promoter (Addgene#109424) in E ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sequences of the control and ZEB1 shRNA were as follows: shRNA control (shCT) (Addgene sequence #1864):
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were injected with one of two control viruses: AAV9-hSyn-DIO-mCherry (AddGene Plasmid #50459), virus titer 2.17 x 1013 or AAV9-hSyn.HI.eGFP-Cre-WPRE-SV40 ...
-
bioRxiv - Neuroscience 2020Quote: ... and control plasmid p-WPXL (Addgene, #12257) were used for Sox9 overexpression and the transfection was performed by using FuGENE6 Transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Copia Renilla Control plasmid (#38093; Addgene) (Lum et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... cells were transfected with control (pcDNA3.1, Addgene) or pcDNA3.1-Myc-eIF4A1 (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... Mitochondrial matrix APEX2 control vector (Addgene #72480) was also subcloned into pBABE-Puro ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pBABE empty control (Addgene cat#1764) vectors were packaged into retroviral particles using the BBS/calcium chloride method as previously described in [8] ...
-
bioRxiv - Neuroscience 2022Quote: ... or control AAV8-CaMKII-EGFP (Addgene#50469) viral vector for viral expression in glutamatergic LHb neurons ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV5: hSyn-DIO-mCherry (control vector, Addgene), or AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV9.hSyn.eGFP.WPRE.bGH as control (Addgene #105539). Bilateral injections were made into AIC at coordinates ...
-
bioRxiv - Microbiology 2023Quote: ... including 1,004 nontargeting control sgRNAs (Addgene, 67989) (18) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nontargeting shRNA control was purchased from Addgene. Single siRNA duplex sequences targeting C1orf112 ...
-
bioRxiv - Cell Biology 2023Quote: ... or control AAV8-TBG-GFP (Addgene #105535) in 100μl saline was injected retro-orbitally into Mboat7f/f or Gpamf/f mice at 8 weeks of age ...
-
bioRxiv - Pathology 2022Quote: ... or control empty plasmids (pLJM1-EGFP, Addgene 19319 and pLenti-C-Myc-DDK-P2A-Puro ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-shGFP control (Addgene, cat#30323); pLKO.1-shATR (TCRN0000039615 ...
-
bioRxiv - Microbiology 2023Quote: ... A no-template preparation (negative control) and a plasmid encoding egfp (positive control, pClneoEGFP human RASSF6b, Addgene plasmid #37021), along with non-transduced EBECs and HBECs were included ...
-
bioRxiv - Cancer Biology 2019Quote: ... Packaging 293T cells were transfected with SAMHD1 sgRNAs (CRISPR SAMHD1) or a non-targeting sgRNA control (Control) and helper vectors (pMD2.G and psPAX2; Addgene plasmid #s 12259 and 12260 respectively ...
-
bioRxiv - Biophysics 2022Quote: ... and pET21a-BirA (Biotin Ligase) was a gift from Alice Ting (Addgene plasmid # 20857 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the control scrambled shRNA (plasmid #1864, Addgene) was provided by Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: Control shRNA was acquired from Addgene (plasmid 1864), from D ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-GFP as transfection control (Addgene #11153) was used to produce lentivirus particles ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-GFP as transfection control (Addgene #11153)) was used for lentiviral production ...
-
bioRxiv - Microbiology 2020Quote: ... or the control plasmid FLuc-eGFP (Addgene #90170) together with the pIRES-3CDpro plasmid using Lipofectamine 2000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or a control MYC-mito tag (Addgene #83355) as previously described37 ...