Labshake search
Citations for Addgene :
1 - 50 of 275 citations for Mouse Anti Streptococcus Pneumoniae Antibody SN4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae ATCC 10031 was used for the OMVs purification. K. pneumoniae was transformed using the calcium chloride method with pGR (K. pneumoniae-pGR) (Addgene, Massachusetts, USA) and PRM-GFP (K ...
-
bioRxiv - Microbiology 2021Quote: ... and PRM-GFP (K. pneumoniae-PRM) (Addgene, Massachusetts, USA) respectively [40,41] ...
-
bioRxiv - Microbiology 2020Quote: ... the Streptococcus pyogenes tracrRNA-encoding sequence from pCas9 (Addgene #42876) was amplified with BKMP45-46 and introduced into pDonorP1-P5 (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: Plasmid pMJ806 containing Streptococcus pyogenes Cas9 was obtained from Addgene (Cambridge, MA). Plasmid pHypaCas9 was a gift from Dr ...
-
bioRxiv - Molecular Biology 2019Quote: Streptococcus pyogenes Cas9 and gRNAs were expressed from the pX330 plasmid (Addgene #42230) (Cong et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... the coding sequence of SpCas9n (Streptococcus pyogenes Cas9) was obtained from pX335 (Addgene #42335) and subcloned into a AAV backbone under the MeCP2 promoter as in [45] ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the Streptococcus Pyogenes dCas9GCN4 was PCR amplified from the PlatTET-gRNA2 plasmid 37 (Addgene #82559), and sub-cloned under the control of a DOX-inducible TRE-3G promoter into a PiggyBac backbone ...
-
bioRxiv - Molecular Biology 2022Quote: ... yeast expression constructs for nuclease-inactivated Cas9 (D10A/H840A mutations) from Streptococcus pyogenes –dCas9 (Addgene #46920) (Gilbert et al 2013 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9 (hSpCas929,50; a gift from Peter Duchek (Addgene plasmid #59985 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9D10A nickase (hSpCas9D10A; a gift from Peter Duchek) (Addgene plasmid ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human codon-optimized Streptococcus pyogenes wild type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cambridge, MA). Chimeric guide RNA expression cassettes with different sgRNAs (sgRNA1 ...
-
bioRxiv - Cancer Biology 2020Quote: Single knockouts were generated either using a two-vector Streptococcus pyogenes (Sp) Cas9 system: LentiV_SpCas9_puro (Addgene, 108100) and LRG2.1 backbone (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9 (hSpCas929,50; a gift from Peter Duchek (Addgene plasmid #59985; http://n2t.net/addgene:59985; RRID:Addgene_59985). All oligos and gBlocks Gene Fragments were purchased from IDT (see Supplementary Table 1 for all oligo and gBlock sequences) ...
-
bioRxiv - Microbiology 2023Quote: HeLa S3 cells were transduced with a Streptococcus pyogenes (sp)Cas9 expressing lentivirus (#52962; Addgene, Watertown, MA) at an MOI of 20 transduction units (TU)/cell ...
-
bioRxiv - Cancer Biology 2020Quote: ... the optimized sgRNA lentiviral expression vector (LRG2.1T) and the lentiviral human codon-optimized Streptococcus pyogenes Cas9 vector (LentiV_Cas9_Puro, Addgene: 108100) were used ...
-
bioRxiv - Cancer Biology 2022Quote: ... human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cat. No. 44719). Two chimeric guide RNA expression cassettes containing two of the following sgRNAs (sgRNA1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9D10A nickase (hSpCas9D10A; a gift from Peter Duchek) (Addgene plasmid: #59985; http://n2t.net/addgene: 59985; RRID: Addgene_59985). For expression in mosquito cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used the sequence of a human codon optimized Streptococcus pyogenes Cas9 (SpCas9) obtained from pX330-U6-Chimeric_BB-CBh-SpCas9 from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cancer Biology 2021Quote: Cas9-expressing stable cell lines were produced by infection with the lentivirus encoding human codon-optimized Streptococcus pyogenes Cas9 protein (LentiV_Cas9_puro, Addgene plasmid # 108100) and subsequent selection with 1 μg/mL puromycin ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Genetics 2021Quote: ... For the pPB_TRE3G::dCas9-5XGCN4_EF1a::TetOn-Hygro, the Streptococcus pyogenes dCas9GCN4 was PCR amplified from the PlatTET-gRNA2 plasmid (Morita et al., 2016) (Addgene #82559), and cloned together with a d2 destabilization domain under control of the TRE3G promoter in a PiggyBac backbone vector also containing the TET-ON3G transactivator and the Hygromycin resistance gene separated by an IRES sequence and under control of the CAG promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid pX330 for expression of human-codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA were obtained from Addgene (Cambridge, MA). The seed sequence for the SpCas9 target site in the target gene was tcggtgcagaccacctcccgcgg (underline ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pX330 plasmid for expression of the human codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA was obtained from Addgene (Cambridge, MA). The seed sequences for the SpCas9 target site in target genes are shown in Table S2 ...
-
bioRxiv - Immunology 2020Quote: ... A549 cells were first made to stably express Streptococcus pyogenes Cas9 following blasticidin selection of cells transduced with lentiCas9-Blast (gift from Feng Zhang, Addgene plasmid # 52962 (19)) ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...