Labshake search
Citations for Addgene :
1 - 50 of 379 citations for Mouse Anti MERS Coronavirus Spike S1 Antibody 3873 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and 1μg truncated coronavirus spike expressing plasmids (SARS: Addgene #170447 ...
-
bioRxiv - Microbiology 2021Quote: ... MERS-CoV (Addgene, #170448) and VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-Spike scFv amino acid sequences were obtained from Addgene plasmids #79125 and #155364 ...
-
bioRxiv - Microbiology 2022Quote: ... Spike ΔC18 (Addgene #: 170442)) ...
-
bioRxiv - Bioengineering 2021Quote: ... The Spike protein from pcDNA3.1-SARS2-Spike was a gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Bioengineering 2020Quote: ... pcDNA3.1-SARS2-Spike (Addgene, #145032) was a gift from Fang Li42 ...
-
bioRxiv - Microbiology 2022Quote: ... Spike-Flag FKO (Addgene #: 159364), Flag-Spike-Flag (Addgene # ...
-
bioRxiv - Microbiology 2022Quote: ... Flag-Spike-Flag (Addgene #: 156418), and David Nemanzee [32] (SARS-CoV Spike ΔC28 (Addgene # ...
-
bioRxiv - Cell Biology 2022Quote: pcDNA3.1-SARS2-Spike (Addgene plasmid #145032), pCEP4-myc-ACE2 (Addgene plasmid #141185) ...
-
bioRxiv - Molecular Biology 2021Quote: ... or pcDNA3.1-SARS2-Spike (Addgene # 145032) or VSV-G plasmid (Addgene plasmid # 8454 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Bioengineering 2023Quote: ... and Spike-18aa truncated (RRID: Addgene_149541) plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... SARS-CoV2-Spike plasmids (Addgene, cat.no. 145032) were transfected into cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Spike-18aa truncated plasmid (Addgene plasmid # 149541) was used as template ...
-
bioRxiv - Microbiology 2022Quote: ... Hyeran Choe [12] (Spike-Flag (Addgene #: 156420), Spike-Flag FKO (Addgene # ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 spike (Addgene #149329), B.1.1.7 SARS-CoV-2 spike (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Cell Biology 2022Quote: The Spike gene was cleaved from pcDNA-Spike plasmid and cloned into lentiviral vector pLV-mCherry (Addgene, Watertown, MA, USA) with removal of mCherry gene to generate pLV-Spike plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pBP_lacZ (Table S1; Addgene accession number 72948) and the purified PCR fragment were digested using SphI and NdeI ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Microbiology 2023Quote: ... and pDONR223 SARS-CoV-2 spike (Addgene #149329) were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223 ...
-
bioRxiv - Immunology 2021Quote: ... was generated by deletion of last 19aa of Spike starting from pcDNA3.1-SARS2-Spike (a gift from Fang Li, Addgene plasmid # 145032). pLenti CMV-GFP-TAV2A-LUC Hygro was generated from pLenti CMV GFP Hygro (Addgene #17446 ...
-
bioRxiv - Immunology 2022Quote: SARS-CoV-2 spike-pseudotyped lentiviruses encoding a luciferase-ZsGreen reporter were produced using the same method but with plasmids encoding SARS-CoV-2 spike (HDM-SARS2-spike-delta21, Addgene #155130) or its variants of concern ...
-
bioRxiv - Neuroscience 2020Quote: ... the following 21-mer shRNA inserts were cloned separately in the pLKO.3G vector (Addgene plasmid #14748): scrambled shRNA (CCTAAGGTTAAGTCGCCCTCG) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20-mer seed sequences with a prepended “G” were restriction cloned into BsmBI-digested sgOpti (Addgene #85681). Inducible dCas9-KRAB expressing cells were transduced in triplicate with sgOpti lentivirus and divided at 24 hours into media with 1 ug/mL puromycin with or without 500 ng / mL doxycycline ...
-
bioRxiv - Biochemistry 2022Quote: Plasmids encoding the full-length spike proteins with native signal peptides were cloned into the background of the HDM-SARS2-Spike-delta21 plasmid (Addgene Plasmid #155130). This construct contains a 21 amino acid c-terminal deletion to promote viral expression ...
-
bioRxiv - Immunology 2022Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Biochemistry 2023Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Genetics 2020Quote: sgRNAs (Supplementary Table S1) were cloned into pLenti-Guide-Puro (Addgene) and delivered to hTERTimmortalized RPE-1 cells carrying a tetracycline-inducible promoter by lentiviral transduction ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV plasmids for DREADD viruses were purchased from Addgene (Table S1) and packaged at the European Molecular Biology Laboratory ...
-
bioRxiv - Synthetic Biology 2023Quote: ... plasmids used in this work (Table S1) were obtained from Addgene. All primers were synthesized by IDT with standard desalting ...
-
bioRxiv - Biochemistry 2021Quote: ... spike was cloned into a pcDNA5-based vector (Addgene #113547) with the following additional N-terminal Ig-Kappa leader and C-terminal epitopes ordered as two separate gBlocks (IDT) ...
-
bioRxiv - Biophysics 2020Quote: ... and 750 ng of Spike-18aa truncated (Addgene plasmid # 149541) were mixed ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1-SARS2-Spike -a gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Immunology 2021Quote: ... and pcDNA 3.1-SARS-CoV-2 Spike (Addgene plasmid #145032) for 72 hours at 37°C under 5% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... and David Nemanzee [32] (SARS-CoV Spike ΔC28 (Addgene #: 170447), Spike ΔC18 (Addgene # ...
-
bioRxiv - Immunology 2024Quote: ... using the SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 (Addgene plasmid # 170447)39 ...
-
bioRxiv - Cancer Biology 2024Quote: ... S1 Table) were annealed and cloned into the pLKO.1 vector (RRID:Addgene_8453) (29 ...
-
bioRxiv - Cell Biology 2023Quote: ... A pair of 20-mer oligonucleotides targeting the 5’ end of the dtat coding sequence was ligated into pAc-sgRNA-Cas9 (Addgene) and validated by sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and either 750 ng of Spike-18aa truncated (Addgene plasmid # 149541), or generated Spike variant plasmids (alpha ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293T cells were transfected with Spike-18aa truncated (Addgene plasmid # 149541), or engineered Spike-variants of concern (Alpha ...
-
bioRxiv - Immunology 2019Quote: ... were incorporated into two complementary 100-mer oligonucleotides and cloned into a gRNA containing plasmid containing the (NeoR/KanR) cassette (Addgene # 41824). The human codon optimized pCAGGS-Cas9-mCherry was used for gene-editing experiments (a gift from Stem Cell Core Facility at Columbia University) ...
-
bioRxiv - Bioengineering 2023Quote: ... The AAV capsid AAV1-X1 was built by inserting a 7-mer peptide between AAs 588-589 of the AAV1 cap gene in AAV1-Rep-Cap (Challis et al. 2019) (Addgene 112862).
-
bioRxiv - Developmental Biology 2019Quote: ... CrispR guides were made by cloning annealed oligos (Table S1) into px458 (Addgene). 2μg of vector DNA were transfected into 8×105 ESCs using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2024Quote: ... carrying a previously constructed helper plasmid (24) (pDY118A, Figure S1, Addgene ID 182958). pDY118A encodes SsrA-tagged SpCas9 (10 ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...