Labshake search
Citations for Addgene :
1 - 50 of 1565 citations for Mouse Anti Hepatitis C Virus Core Protein Antibody 1864 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Hepatitis Delta Virus sequence from the pSVL(D3) plasmid99 (Addgene plasmid #29335) (https://www.addgene.org/29335/) ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKOshScr (Addgene #1864), pshPVR (ABM #i018439 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The shRNAs used were either purchased from Addgene (shCtrl: Addgene #1864) or designed using the Genetic Perturbation Platform.
-
bioRxiv - Neuroscience 2020Quote: ... the AAV1.CaMKIIa.hChR2(H134R)-eYFP.WPRE.hGH virus (Penn Vector Core, Addgene 269696P ...
-
bioRxiv - Molecular Biology 2021Quote: ... David Sabatini (Addgene #1864). ShRNA oligonucleotides against human FTO ...
-
bioRxiv - Molecular Biology 2020Quote: ... was ordered from Addgene (scramble shRNA, Addgene # 1864).
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from David Sabatini (Addgene plasmid # 1864; http://n2t.net/addgene:1864; RRID:Addgene_1864),145 shRNA against DOT1L (CGCCAACACGAGTGTTATATT ...
-
bioRxiv - Genomics 2019Quote: ... and Scramble (Addgene no. 1864) shRNAs served as controls.
-
bioRxiv - Cancer Biology 2022Quote: ... or pLKO.shScramble (Addgene Plasmid #1864) lentiviral vectors ...
-
bioRxiv - Cell Biology 2022Quote: ... was from Addgene (cat. # 1864).
-
bioRxiv - Developmental Biology 2019Quote: ... a scramble shRNA (Addgene-1864) targeting a random sequence 5’-CCTAAGGTTAAGTCGCCCTCGC-3’ was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO scrambled shRNA (Addgene (#1864)) was used as control.
-
bioRxiv - Microbiology 2023Quote: ... David Sabatini (Addgene plasmid # 1864). 8 hr post-transfection ...
-
bioRxiv - Microbiology 2024Quote: ... scramble shRNA was a gift from David Sabatini (Addgene plasmid # 1864 ; http://n2t.net/addgene:1864 ; RRID:Addgene_1864)78 ...
-
bioRxiv - Neuroscience 2021Quote: Visual cortex was injected with a virus expressing GCaMP6s (AAV9.Syn.GCaMP6s.WPRE.SV40, Penn Vector Core; AAV1.hSyn1.mRuby2.GSG.P2A.GCaMP6s.WPRE.SV40, Addgene) at 3 to 5 sites (1-2 μl ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 Scrambled shRNA (#1864, Addgene), pLKO.1 HIF2α shRNA (#TRCN0000082307 ...
-
bioRxiv - Cell Biology 2022Quote: ... David Sabatini (MIT) (Addgene plasmid # 1864). Cells were selected for using 1mg/mL puromycin.
-
bioRxiv - Developmental Biology 2022Quote: ... A scramble shRNA (Addgene-1864, CCTAAGGTTAAGTCGCCCTCGC) was used as control ...
-
bioRxiv - Developmental Biology 2020Quote: ... pLKO.1-shSCR (Addgene, Plasmid #1864), was obtained from Addgene (Cambridge ...
-
bioRxiv - Genomics 2022Quote: ... and a scrambled control (Addgene 1864). In parallel ...
-
bioRxiv - Cancer Biology 2024Quote: ... scrambled shRNA control (Addgene plasmid #1864), or an empty backbone pLKO.1 control (Addgene plasmid #8453 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control vectors pGIPZ (Dharmacon) or pLKO.1 (a gift from David Sabatini, Addgene plasmid #1864; http://n2t.net/addgene:1864; RRID:Addgene_1864) were employed for Vangl2-depletion studies ...
-
bioRxiv - Neuroscience 2020Quote: ... Scramble shRNA was used for control electroporations and was a gift from David Sabatini (Addgene plasmid # 1864; http://n2t.net/addgene:1864; RRID:Addgene_1864). Raptor_1 shRNA was a gift from David Sabatini (Addgene plasmid # 1857 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or a control shRNA (a gift from David Sabatini; Addgene plasmid #1864; http://n2t.net/addgene:1864; RRID: Addgene_1864) (52 ...
-
bioRxiv - Systems Biology 2023Quote: ... The control was Eahy926 cells transfected with a control plasmid (a gift from David Sabatini (Addgene plasmid #1864; http://n2t.net/addgene:1864; RRID:Addgene_1864)) (48) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scramble shRNA pLKO.1 vector (Addgene, 1864) was used as a control.
-
bioRxiv - Cell Biology 2023Quote: ... except for the scramble shRNA which was obtained from Addgene (a gift from David Sabatini, Addgene #1864). The knockdown efficiencies of shRNAs were provided by Sigma-Aldrich using quantitative PCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the control scrambled shRNA (plasmid #1864, Addgene) was provided by Dr ...
-
bioRxiv - Cancer Biology 2021Quote: Control shRNA was acquired from Addgene (plasmid 1864), from D ...
-
bioRxiv - Molecular Biology 2020Quote: ... a gift from David Sabatini (Addgene plasmid # 1864) (36) ...
-
bioRxiv - Cell Biology 2022Quote: ... a gift from David Sabatini (Addgene plasmid # 1864) were used ...
-
bioRxiv - Genomics 2023Quote: ... a scrambled control sequence (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG, Addgene cat. #1864), were each cloned into pLKO.1 puro lentiviral vectors (Addgene cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... or a non-targeting control (Addgene, plasmid 1864). For knockdown experiments ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Immunology 2023Quote: ... A scramble shRNA-expressing pLKO.1 (Addgene Plasmid #1864) was used as control (shScr) ...
-
bioRxiv - Neuroscience 2021Quote: ... was loaded with the GCaMP6s virus (AAV9.Syn1.GCaMP6s.WPRE.SV40, ≈1.9x1013 GC/ml, Penn Vector Core; RRID: Addgene_100843) and was slowly lowered into VTA (DV -8.1 mm relative to brain surface) ...
-
bioRxiv - Neuroscience 2022Quote: ... 70–100 nl of AAV5-CaMKIIa-hChR2(H134R)-EYFP (UNC vector core, Karl Deisseroth virus stock/ Addgene #26969) was injected into either the ventral (AP = −2.8 – −3.1 mm ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-hSYN1::mTurquoise2 (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #99125), AAV-DJ-hSYN1::mCherry (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a non-targeting control (obtained through (Addgene, plasmid 1864), as shown in Table S3 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-EF1α::CVS-G (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #67528), AAV-DJ-EF1-DIO-tdTomato (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scramble shRNA was a gift from David Sabatini (Addgene plasmid # 1864) (Sarbassov et al. ...
-
bioRxiv - Physiology 2022Quote: ... and scrambled shRNA plasmid (SC: ID 1864) were obtained from Addgene. HEK293T cells in 10 cm dishes were transfected using 50 μL 0.1% polyethylenimine ...
-
bioRxiv - Molecular Biology 2023Quote: ... The shRNAs used were either purchased from Addgene (shCtrl: Addgene #1864) or designed using the Genetic Perturbation Platform.
-
bioRxiv - Physiology 2022Quote: ... and scrambled shRNA plasmid (SC: ID 1864) were obtained from Addgene. HEK293T cells in 10 cm dishes were transfected using 50 μL 0.1% polyethylenimine ...
-
bioRxiv - Physiology 2023Quote: ... pLKO.1-Puro-scramble shRNA (1864) plasmids were obtained from Addgene. The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pKLO.1 containing a non-targeting sequence (Addgene #1864) (Sarbassov et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 nl of AAV (AAV8-hSyn-DIO-mCherry, plasmid from Addgene #44361, virus packed at UNC Vector Core 109; AAV8-hSyn-DIO-hM3Dq-mCherry plasmid from Addgene #50459 ...