Labshake search
Citations for Addgene :
1 - 50 of 753 citations for Monobenzyl Phthalate Unlabeled 100 Ug Ml In Methyl Tert Butyl Ether since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
bioRxiv - Cancer Biology 2020Quote: TERT (Addgene plasmid #1771) and a dominant-negative mutant (DN-TERT ...
-
Telomerase deficiency in humans is associated with systemic age-related changes in energy metabolismbioRxiv - Cell Biology 2022Quote: pBABE retroviral vectors on the puromycin-resistant backbone expressing TERT and TERT-HA (Counter et al., 1998) or the empty vector were obtained from Addgene Europe ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 1 ug total DNA (0.5 ug PCR product and 0.5 ug AsCpf1_TATV Cas12 [Addgene: 89354]) using Xtreme-GENE 9 following manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and a dominant-negative mutant (DN-TERT) (Addgene plasmid #1775), and different members of the MIR500 cluster (pre-MIR532 ...
-
bioRxiv - Immunology 2021Quote: ... 0.88 ug lentiviral transfer plasmid along with 0.66 ug pSPAX2 (Addgene plasmid #12260) and 0.44 ug pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Genomics 2020Quote: ... Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138) containing spCas9 and GFP ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 15 ug of psPAX2 (Addgene) were added into 3 ml OptiMEM (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.16 ug pMDLg/pRRE (Addgene #12251), 700 ng pMD2.G (Addgene #12259 ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... unlabeled HeLa-TDS cells were transfected with CENP-B-INCENP-GFP (Addgene, plasmid #45238), and for live-cell imaging also with mCherry-PRC1 plasmid provided by Casper C ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3.2 ug pMD2.G (Addgene plasmid # 12259) and 10 ug of the plasmid of interest ...
-
bioRxiv - Bioengineering 2020Quote: ... 1.5 ug pCMV-PE2 plasmid (Addgene #132775), 500 ng pegRNA plasmid (cloned into Addgene #132777) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and one ug pMD2.G (Addgene #12259) into a 10-cm dish of 293FT cells (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: Three ug of pAAV2 vector (Addgene #89771) was digested with MluI/BstEII to release the insert between the two ITRs ...
-
bioRxiv - Genetics 2021Quote: ... The TERT-immortalized human melanocyte cell C283T was infected with pCW-Cas9-Blast from Addgene followed by introduction of lentiGuide-Puro (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag-FKHR-AAA mutant; Addgene) (15) ...
-
bioRxiv - Immunology 2021Quote: ... and 0.44 ug pMD2.G (Addgene plasmid #12259), kind gifts from Didier Trono ...
-
bioRxiv - Cell Biology 2019Quote: ... 11.3 ug of each half library was co-transfected with 17 ug of psPAX2 (Addgene #12260, a gift from Didier Trono) and 11.3 ug of pCMV-VSV-G (addgene #8454 ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... pMD2.G and pRSV/Rev (2.88 ug total, Addgene) plus pMK1221-control or −GR shRNA (2.88 ug shCtrl or shGR ...
-
bioRxiv - Immunology 2023Quote: ... and 3.5 ug of PmD2.G (Addgene, Cat #12259) using Lipofectamine 2000 transfection reagent (Invitrogen cat # 11668019) ...
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Microbiology 2020Quote: ... 36 ug of pRSV-Rev packaging plasmid (containing Rev, Addgene), 18 ug of pMD2.g packaging plasmid (containing VSV-G envelope ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.25 ug of left and right AAVS1 TALEN plasmids (Addgene plasmid no ...
-
bioRxiv - Genomics 2020Quote: ... we used 40 ug p2T CBh Cas9 BlastR (Addgene 71489), 40 ug gRNA plasmid ...
-
bioRxiv - Immunology 2023Quote: ... 10 ug pRSV-Rev (kind gift from Didier Trono (Addgene plasmid #12253 ...
-
bioRxiv - Immunology 2023Quote: ... 15 ug pMDLg/pRRE (kind gift from Didier Trono (Addgene plasmid #12251 ...
-
bioRxiv - Microbiology 2020Quote: ... 90 ug of pMDLg/pRRE packaging plasmid (containing Gag & Pol, Addgene), 36 ug of pRSV-Rev packaging plasmid (containing Rev ...
-
bioRxiv - Cancer Biology 2021Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag FKHR AAA mutant; gift from Kunliang Guan; Addgene plasmid # 13508) using polyethyleneimine ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary fibroblasts were immortalized with 293FT (Invitrogen)-derived supernatant containing a human telomerase reverse transcriptase (TERT) lentivirus that was generated with the plasmids pLV-hTERT-IRES-hygro (gift from Tobias Meyer; Addgene #85140)(24) ...
-
bioRxiv - Microbiology 2020Quote: ... 18 ug of pMD2.g packaging plasmid (containing VSV-G envelope, Addgene). Transfection was performed using Lipofectamin 2000 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2021Quote: ... 100-200 nL of rAAV2-retro jGCaMP7s (~1e13 gc/mL, Addgene) was injected at a rate of 70 nL·min-1 using a Microinject system (World Precision Instruments) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5ug of plasmid library was co-transfected with four ug PsPAX2 (Addgene #12260) and one ug pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2021Quote: ... Each transfection condition contained 0.5 ug of a plasmid encoding GCaMP6s (Addgene #40753) and 1.5 ug of the plasmid encoding the appropriate olfactory receptor ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 ug of DNA (the pegRNA plasmid and the pCMV-PE2 plasmid (Addgene #132775) at a 1:2 ratio by mass of pegRNA plasmid:PE2) ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of CROPseq-Guide-Puro (Addgene #86708) for 2 h at 37 °C with 2 ul of FastDigest Mph1103I (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2-CAG-TdTomato (100 µL, 5.3 x 1012 GC/ml, Addgene 59462-AAV2) was injected intravitreally 4 mm posterior to the nasal aspect of the limbus ...
-
bioRxiv - Systems Biology 2022Quote: ... we first prepare the vector backbone by incubating 5 ug of PB-TRE-dCas9-VPR (Addgene #63800) for 2 h at 37°C with 2 ul of FastDigest FspAI (ThermoFisher cat ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...
-
bioRxiv - Immunology 2021Quote: ... 80% confluent) were co-transfected with 2.4-ug of pLenti-pLex307-ACE lentiviral transfer plasmid (Addgene: 158448), 0.8-ug of pVSV-G ...
-
bioRxiv - Microbiology 2023Quote: ... was combined with 1 ug lenti CRISPR V2 plasmid (a gift from Feng Zhang, Addgene plasmid #52961) expressing the guide RNA (gRNA ...
-
bioRxiv - Immunology 2023Quote: ... 10 ug pRSV-Rev (kind gift from Didier Trono (Addgene plasmid #12253; http://n2t.net/addgene:12253; RRID:Addgene_12253), 15 ug pMDLg/pRRE (kind gift from Didier Trono (Addgene plasmid #12251 ...
-
bioRxiv - Immunology 2023Quote: ... 15 ug pMDLg/pRRE (kind gift from Didier Trono (Addgene plasmid #12251; http://n2t.net/addgene:12251; RRID:Addgene_12251), and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 200 uL of OptiMEM with 0.8 ug of the I-SceI expression plasmid (pCBASce, Addgene #60960). The media was replaced the next morning and the cells were trypsinized 48-hours post-transfection for analysis of GFP expression by flow cytometry (BD Biosciences).
-
bioRxiv - Neuroscience 2021Quote: AAV5.CaMKII.hChR2 (H134R)-mCherry (100 μL at titer ≥ 1 × 10 13 vg/mL) from Addgene was injected in 4-week-old rats intracerebrally in the right somatosensory forepaw region ...