Labshake search
Citations for Addgene :
1 - 50 of 256 citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... amplified without its stop codon from plasmid pCFJ104 (Addgene), was placed directly downstream of 1,714 bp of the spe-50 promoter sequence and was followed by the spe-50 genomic sequence and 448 bp of the 3’ UTR ...
-
bioRxiv - Genetics 2023Quote: ... TALEN-R (Addgene #35432) and pJT039 (AAVS1-9xTetO-pEF-IGKleader-Cas9site-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA ...
-
bioRxiv - Neuroscience 2019Quote: CAG-Mito-R-GECO: CMV-Mito-R-GECO1 (a gift from Robert Campbell; Addgene plasmid # 46021 ...
-
bioRxiv - Bioengineering 2021Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Cell Biology 2019Quote: ... pCMV-R-CEPIA1er (Addgene #58216) [60] ...
-
bioRxiv - Neuroscience 2021Quote: ... and R-CEPIA1er (Addgene #58216) (38) ...
-
bioRxiv - Microbiology 2019Quote: ... R-CEPIA1er (Addgene plasmid #58216), and GCaMP6s were cloned into pLVX-IRES-Hygro ...
-
bioRxiv - Cell Biology 2019Quote: ... Mito-R-GECO1 (Addgene, #46021) is previously described in (Wu et al. ...
-
bioRxiv - Genetics 2020Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Systems Biology 2022Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Systems Biology 2023Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Cell Biology 2023Quote: ... and TALEN-R (Addgene 35432) plasmid targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Cancer Biology 2023Quote: ... Transfer lentiviral plasmids (2500 ng) were diluted in 200 µl serum-free medium together with 225 ng pCMV-VSV-G (Addgene #8454) and 2250 ng psPAX2 (Addgene #12260 ...
-
bioRxiv - Biophysics 2021Quote: ... R-GNB1 was generated by swapping R against EGFP in EGFP-GNB1 described previously (Addgene #133856) using restriction sites AgeI and BsrGI (8) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Cre-containing plasmid was obtained from Addgene (pLM-CMV-R-Cre, Addgene #27546). A fragment encoding the CMV promoter and mCherry-T2A-Cre-WPRE was excised by NdeI and SacII (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... pUC-DEST-R3R4(R) (Addgene #141010) the Gateway LR Clonase II Enzyme Mix.
-
bioRxiv - Cell Biology 2020Quote: ... pCMV-R-GECO1 (Addgene Plasmid #32444), pCMV-mCherry-CD9 (Addgene Plasmid #55013) ...
-
bioRxiv - Cell Biology 2021Quote: ... pUC-DEST-R3R4(R) (Addgene #141010) and the Gateway LR Clonase II Enzyme Mix (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... and TALEN-R (Addgene no. 35432) plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Ub-R-EGFP under CUP1 promoter was cloned from the plasmid pYES2-Ub-R-EGFP (Addgene #11953) (29 ...
-
bioRxiv - Developmental Biology 2021Quote: ... to clone the region into the VanGlow vector without the DSCP (Addgene#83342) (Janssens et al. ...
-
bioRxiv - Neuroscience 2019Quote: CAG-Mito-R-GECO: CMV-Mito-R-GECO1 (a gift from Robert Campbell; Addgene plasmid # 46021, RRID:Addgene_46021 (74)) was digested PmeI and the mito-R-Geco fragment was subcloned into EcoRV-digested pBSKII SK+ (Stratagene) ...
-
bioRxiv - Genetics 2020Quote: The primers ABEmax-F/ABEmax-R and AncBE4max-F/ AncBE4max-R was used to amplified pCMV_ABEmax_P2A_GFP (Addgene #112101) and pCMV_AncBE4max (Addgene #112094 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The predicted r-opsin1 TALENs were constructed in vitro using Golden Gate assembly protocol (Golden Gate TAL Effector Kit 2.0, Addgene #1000000024) [88] ...
-
bioRxiv - Neuroscience 2022Quote: ... pTorPE-R-GECO1 (62) (Addgene Plasmid # 32465) was a gift from Robert Campbell (University of Alberta) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and AAVS1 TALEN-R (Addgene plasmid #59026) 84 were used for targeting the UBrtTA ...
-
bioRxiv - Biochemistry 2023Quote: ... Plasmid pCMV-R-GECO1 (Addgene Plasmid # 32444) was a gift from Robert E ...
-
bioRxiv - Cell Biology 2021Quote: ... the sequence coding for R-GECO1 including TorA-tag from pTorPE-R-GECO1 (a gift from Robert Campbell (Addgene plasmid #32465 ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1.5 μg AAVS1 TALEN R (Addgene 59026) via the Neon Electroporation System (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting TGTCCCCTCCACCCCACA and AAVS1-TALEN-R (Addgene #35432) targeting TTTCTGTCACCAATCCTG) ...
-
bioRxiv - Genetics 2023Quote: ... and 1.5 µg AAVS1 TALEN R (Addgene 59026) using Lipofectamine 3000 Transfection Reagent (Invitrogen L3000015 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9.syn.flex.GcaMP6s (Addgene, Catalog# pNM V3872TI-R(7.5)) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9.syn.flex.GcaMP6s (Addgene, Catalog# pNM V3872TI-R(7.5)) ...
-
bioRxiv - Developmental Biology 2020Quote: ... gRNA oligos for WNT11 (F: CACCGGTCCTCGCTCCTGCGTGGGG; R: AAACCCCCACGCAGGAGCGAGGACC) and PAX2 (F: CACCGATGACCGCCACTAGTTACCG; R: AAACCGGTAACTAGTGGCGGTCATC) were synthesized and cloned into the lentiCRISPR v2 plasmid (Addgene # 52961). First ...
-
bioRxiv - Cell Biology 2021Quote: ... and cytosolic Ca2+ was monitored by the intensity of the sensor R-GECO (plasmid was a gift from R. Campbell, Addgene #45494). To decrease cytosolic Ca2+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Genomics 2019Quote: ... where luc2 ORF with or without a minimal promoter was ligated from pMPRAdonor2 and pMPRAdonor1 (Addgene), respectively ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Cancer Biology 2021Quote: The M-CSF promoter reporter (pMCSF-R-luc Addgene plasmid # 12420 ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Plant Biology 2020Quote: ... the Hip1 sequence was amplified without signal peptide and cloned into the pET28a (+) expression vector (Addgene, USA), eventually having a His-tag at the N-terminus ...
-
bioRxiv - Synthetic Biology 2020Quote: Ub-R-GFP was a gift from Nico Dantuma (Addgene plasmid # 11939 ...
-
bioRxiv - Molecular Biology 2022Quote: ... target DNA sequence was cloned into 13S-R (Addgene # 48328). For testing the CRISPR interference in vivo ...
-
bioRxiv - Neuroscience 2020Quote: Primers containing linkers attached to each target without the PAM sequence were used for PCR with pCFD4 (RRID:Addgene_49411) as a template ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...
-
bioRxiv - Developmental Biology 2022Quote: ... wnt8a/pcs2+ (XE10, from R. Moon; Addgene plasmid 16865; BamHI/T3). Antisense RNA probes labelled with digoxygenin-11-UTP (Roche ...