Labshake search
Citations for Addgene :
1 - 50 of 68 citations for Lamin B2 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Cancer Biology 2022Quote: mCherry-Lamin A/C (Addgene #55068) and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1μgRNA-B2 plasmid and 1μg Cas9 Nickase(D10A)-GFP plasmid (Addgene #48140) or Hu CAS9-GFP (Addgene #44720 ...
-
bioRxiv - Cell Biology 2021Quote: pTRIP-SFFV-EGFP-NLS and the coding sequences of mEmerald-Lamin A/C and mEmerald-Lamin B1 were from Addgene. pLVX-N-GFP was a kind gift from Prof ...
-
bioRxiv - Biophysics 2023Quote: ... and mRuby2-Lamin A/C (Addgene plasmid # 55901) were produced in HEK293T cells ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-Lamin A-C-18 (Addgene plasmid no. 54138) and mEmerald-Nucleus-7 (Addgene plasmid no ...
-
bioRxiv - Biochemistry 2020Quote: BsaI sites and compatible overhangs were added by PCR amplification of cpGFP from pTKEI-Mal-B2 (Addgene Plasmid #79756) using primers cpGFP-BsaI-GG-F and cpGFP-BsaI-GG-R ...
-
bioRxiv - Microbiology 2023Quote: The pcDNA3.1-puro empty vector was cloned by replacing the coding sequence of pcDNA3.1 puro Nodamura B2 (Addgene #17228) with the pcDNA3.1(+ ...
-
bioRxiv - Biophysics 2021Quote: ... The mCherry-lamin B1-10 was a gift from Michael Davidson (Addgene plasmid #55069). GFP-tagged rat connexin-43 was generated earlier [25] ...
-
bioRxiv - Cell Biology 2022Quote: ... pBABE-puro-GFP-lamin A was a gift from Tom Misteli (Addgene plasmid #17662) (54).
-
bioRxiv - Cell Biology 2023Quote: Plasmids encoding recombinant WT (RRID:Addgene_92100) and M880A mutant human GST-TAF3-PHD were kindly provided by Albert Jeltsch (Kungulovski et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... was used to generate a Ser301 to Asp (S301D) mutant of lamin A/C from the wildtype lentiviral vector pCDH_blast_MCS_Nard_GFP_LAMIN (Addgene #167340) 64 ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cell Biology 2022Quote: 6.0 × 10^6 BJAB clone B2 cells expressing both Cas9 and ERAAP dsRed were transduced with lentivirus of human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at an MOI of 0.4 using spin-infection (1,000 g for 2 h at 33 °C) ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant strains harbouring pTEC19 plasmid (Addgene, #30178) and producing the fluorescent protein E2-Crimson were grown in Middlebrook 7H9 broth supplemented with 0.2% glycerol (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Cell Biology 2019Quote: ... The donor plasmid to insert mEGFP into the N-terminus of lamin B1 was purchased from Addgene (Cat# 87422). TrueCut Cas9 protein v2 and TrueGuide 1-piece modified synthetic gRNA (GGGGTCGCAGTCGCCATGGC ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then additionally modified with lentiviral vectors to express Lamin A (pCDH-CMV-hLamin_A-IRES-copGFP-EF1-puro [27], available through Addgene (#132773)) or the control plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...
-
bioRxiv - Biophysics 2020Quote: ... we overexpressed lamin A by transiently transfecting the intact cells with m-Cherry tagged plasmid DNA for lamin A which was a gift from Michael Davison (Addgene, plasmid # 55068). To surpass lamin A expression ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 × 106 cells of each cell line were electroporated with a mixture of 10 μg of plasmid pEGFP-D50 lamin A (Addgene plasmid #17653) that had been linearized with EagI and 1 μg of pBABE-puro (Addgene plasmid #1764 ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant SidK1-278 encoded by plasmid pSAB35 (Addgene plasmid #175787) was expressed in E ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant human PRKACA cDNA was obtained from Addgene (Plasmid #23495) and cloned into between BamHI and KpnI in pcDNA5 vector (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used in generating recombinant SA11 rotaviruses were obtained from Addgene [https://www.addgene.org/Takeshi_Kobayashi/] and included pT7/VP1SA11 ...
-
bioRxiv - Cell Biology 2023Quote: ... transduced with recombinant adeno-associated virus (rAAV) (Addgene, pAAV TBG FFLuc) supernatant ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid for tagging the N-terminus of the human lamin B1 gene (LMNB1) with RFP was purchased from Addgene (LMNB1-mTagRFP-T, #114403). The plasmid sequence was validated by Sanger sequencing.
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Biophysics 2022Quote: Recombinant MBP-FUS construct was kindly gifted by Nicolas Fawzi (Addgene plasmid #98651) and was expressed in BL21 (DE3 ...
-
bioRxiv - Physiology 2019Quote: ... as were plasmids for recombinant production of PGC-1α (Addgene #1028 and 1029) (Puigserver et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant lentiviral particles were produced using a protocol provided by the manufacturer (Addgene). In brief ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant Lentiviral Vector encoding Myoc Y437H was constructed from plasmids pLentCMV-GFP(Addgene 17448)(Campeau et al. ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant plasmid along with a pBabe-puro construct (Addgene, 1764; deposited by Dr. Hartmut Land) expressing mouse ATG16L1 variants was transfected into HEK293 ATG13_KO GFP-LC3B cells via Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type and mutant SpCas9 (1-1,368) possessing a C-terminal decahistidine tag (Addgene, no. 62731) was expressed and purified as described previously (35) ...
-
bioRxiv - Genetics 2022Quote: Recombinant AAV-PHP.eB [13] was packaged in AAVpro 293T cells by co-transfection of PHP.eB (Addgene, 103005), pHelper (Agilent ...
-
bioRxiv - Molecular Biology 2021Quote: ... at this stage CoA-LD555 (Lumidyne) was conjugated to Brn1-ybbR with recombinant SFP synthase (Addgene Plasmid #75015) as previously described (Yin et al. ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus carrying the GCaMP6f gene (AAV2/1:hSyn-GCaMP6f) was obtained from Addgene (100837-AAV1) with titer ≥ 1×1012 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A recombinant DNA pcDNA3/Myc-DNMT1 was a gift from Arthur Riggs (Addgene plasmid #36939 Watertown, MA, USA) (Li et al. ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Immunology 2020Quote: ... The recombinant DNA encoding TCRMART-1 was synthesized by GeneScript (Nanjing, China) and ligated into pRRLSIN.cPPT.PGK vector (Addgene, 12252).
-
bioRxiv - Neuroscience 2023Quote: ... The recombinant AAV to express SaCas9 was created using plasmid pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA (Addgene, #113688). For constructs for REST4 expression ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636; http://n2t.net/addgene:36046; RRID:Addgene_36046) and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...