Labshake search
Citations for Addgene :
1 - 50 of 401 citations for Lamin A C Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: mCherry-Lamin A/C (Addgene #55068) and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Biophysics 2023Quote: ... and mRuby2-Lamin A/C (Addgene plasmid # 55901) were produced in HEK293T cells ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-Lamin A-C-18 (Addgene plasmid no. 54138) and mEmerald-Nucleus-7 (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2021Quote: pTRIP-SFFV-EGFP-NLS and the coding sequences of mEmerald-Lamin A/C and mEmerald-Lamin B1 were from Addgene. pLVX-N-GFP was a kind gift from Prof ...
-
bioRxiv - Cancer Biology 2023Quote: ... was used to generate a Ser301 to Asp (S301D) mutant of lamin A/C from the wildtype lentiviral vector pCDH_blast_MCS_Nard_GFP_LAMIN (Addgene #167340) 64 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type and mutant SpCas9 (1-1,368) possessing a C-terminal decahistidine tag (Addgene, no. 62731) was expressed and purified as described previously (35) ...
-
bioRxiv - Biophysics 2021Quote: ... The mCherry-lamin B1-10 was a gift from Michael Davidson (Addgene plasmid #55069). GFP-tagged rat connexin-43 was generated earlier [25] ...
-
bioRxiv - Cell Biology 2022Quote: ... pBABE-puro-GFP-lamin A was a gift from Tom Misteli (Addgene plasmid #17662) (54).
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression plasmid for Ism1 with C-terminal myc-6xhis tag plasmid for recombinant Ism1 protein production was from Addgene (#173046).
-
bioRxiv - Biochemistry 2022Quote: ... For expression of recombinant drosophila c-Src isoform 42A (Src42A, UniProtKB Q9V9J3) we used a pET-His10-Src42A plasmid (Addgene #126674) codifying a full-length drosophila isoform (aa 1-517 ...
-
bioRxiv - Cell Biology 2023Quote: Plasmids encoding recombinant WT (RRID:Addgene_92100) and M880A mutant human GST-TAF3-PHD were kindly provided by Albert Jeltsch (Kungulovski et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant strains harbouring pTEC19 plasmid (Addgene, #30178) and producing the fluorescent protein E2-Crimson were grown in Middlebrook 7H9 broth supplemented with 0.2% glycerol (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Cell Biology 2019Quote: ... The donor plasmid to insert mEGFP into the N-terminus of lamin B1 was purchased from Addgene (Cat# 87422). TrueCut Cas9 protein v2 and TrueGuide 1-piece modified synthetic gRNA (GGGGTCGCAGTCGCCATGGC ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then additionally modified with lentiviral vectors to express Lamin A (pCDH-CMV-hLamin_A-IRES-copGFP-EF1-puro [27], available through Addgene (#132773)) or the control plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...
-
bioRxiv - Biophysics 2020Quote: ... we overexpressed lamin A by transiently transfecting the intact cells with m-Cherry tagged plasmid DNA for lamin A which was a gift from Michael Davison (Addgene, plasmid # 55068). To surpass lamin A expression ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 × 106 cells of each cell line were electroporated with a mixture of 10 μg of plasmid pEGFP-D50 lamin A (Addgene plasmid #17653) that had been linearized with EagI and 1 μg of pBABE-puro (Addgene plasmid #1764 ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant SidK1-278 encoded by plasmid pSAB35 (Addgene plasmid #175787) was expressed in E ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant human PRKACA cDNA was obtained from Addgene (Plasmid #23495) and cloned into between BamHI and KpnI in pcDNA5 vector (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used in generating recombinant SA11 rotaviruses were obtained from Addgene [https://www.addgene.org/Takeshi_Kobayashi/] and included pT7/VP1SA11 ...
-
bioRxiv - Cell Biology 2023Quote: ... transduced with recombinant adeno-associated virus (rAAV) (Addgene, pAAV TBG FFLuc) supernatant ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid for tagging the N-terminus of the human lamin B1 gene (LMNB1) with RFP was purchased from Addgene (LMNB1-mTagRFP-T, #114403). The plasmid sequence was validated by Sanger sequencing.
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Biophysics 2022Quote: Recombinant MBP-FUS construct was kindly gifted by Nicolas Fawzi (Addgene plasmid #98651) and was expressed in BL21 (DE3 ...
-
bioRxiv - Physiology 2019Quote: ... as were plasmids for recombinant production of PGC-1α (Addgene #1028 and 1029) (Puigserver et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant lentiviral particles were produced using a protocol provided by the manufacturer (Addgene). In brief ...
-
bioRxiv - Bioengineering 2021Quote: ... the sequence encoding the PE2 C terminus (PE2-C term) (Addgene #132775), and the WPRE sequence (Addgene #52962 ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant Lentiviral Vector encoding Myoc Y437H was constructed from plasmids pLentCMV-GFP(Addgene 17448)(Campeau et al. ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...
-
bioRxiv - Biochemistry 2020Quote: ... pDEST26-C-FLAG (Addgene #79275) [22] vector ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Met (Addgene; 31784) plasmids were purchased from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pOPARA2 or pPGC-C (Addgene plasmid # 174580 ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant plasmid along with a pBabe-puro construct (Addgene, 1764; deposited by Dr. Hartmut Land) expressing mouse ATG16L1 variants was transfected into HEK293 ATG13_KO GFP-LC3B cells via Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... NM_018344.6 (SLC29A3):c.1427A>G (p.Ter476Trp) and NM_000343.4(SLC5A1):c.1993T>C (p.Ter665Arg)) were cloned into pCDNA3.1-HA (Addgene 128034) using Gibson assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... pMXs-c-Myc (Addgene Plasmid #13375) per 10 cm dish using Fugene 6 (Catalog# Promega# E2691) ...