Labshake search
Citations for Addgene :
1 - 50 of 229 citations for IFN gamma Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Gamma (Addgene # 170450), Delta (Addgene # 172320) ...
-
bioRxiv - Microbiology 2024Quote: ... 20ng encoding firefly luciferase driven by an IFN-beta promoter (IFN-Beta_pGL3, Addgene 102597), 5ng of renilla luciferase (pRL-TK - Promega E2241) ...
-
bioRxiv - Microbiology 2022Quote: ... IFN-Beta-pGL3 (Addgene 102597), or empty vector pcDNA3.1 (Life Technologies V79020 ...
-
bioRxiv - Immunology 2019Quote: ... The reporter plasmid IFN-β-Luc (IFN-Beta_pGL3) was a gift from Nicolas Manel (Addgene plasmid # 102597) [59] ...
-
bioRxiv - Neuroscience 2020Quote: GFP-PIPK1 gamma 90 was a gift from Pietro De Camilli (Addgene plasmid # 22299 ...
-
bioRxiv - Cell Biology 2022Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104433 ...
-
An in vitro platform for quantifying cell cycle phase lengths in primary human intestinal stem cellsbioRxiv - Cell Biology 2023Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid #104433 ...
-
bioRxiv - Biochemistry 2023Quote: ... and actin (pACEBac1-gamma-TuRC-GFP) were a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-PIPK1 gamma 90 was a gift from Pietro De Camilli (Addgene plasmid # 22299) and subcloned with mScarlet-I into mammalian expression plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: ... IFN-Beta_pGL3 was a gift from Nicolas Manel (Addgene plasmid # 102597). pLenti-CMV-GFP-Blast (659-1 ...
-
bioRxiv - Microbiology 2021Quote: ... Flag-tagged full-length Human gamma-catenin construct in the pcDNA3 vector was obtained from Addgene (plasmid #16827).
-
bioRxiv - Cell Biology 2022Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104433 ; http://n2t.net/addgene:104433; RRID:Addgene_104433)49
-
bioRxiv - Biochemistry 2023Quote: ... and actin (pACEBac1-gamma-TuRC-GFP) were a gift from Tarun Kapoor (Addgene plasmid # 178079 ; http://n2t.net/addgene:178079 ; RRID:Addgene_178079). Plasmids were transformed into DH10MultiBacTurbo cells (ATG:biosynthetics GmbH ...
-
An in vitro platform for quantifying cell cycle phase lengths in primary human intestinal stem cellsbioRxiv - Cell Biology 2023Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid #104433; http://n2t.net/addgene:104433; RRID:Addgene_104433), and pmScarlet_H2A_C1 was a gift from Dorus Gadella (Addgene plasmid #85051 ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ; http://n2t.net/addgene:178079 ; RRID:Addgene_178079)) using the following primers ...
-
bioRxiv - Neuroscience 2020Quote: GFP-PIPK1 gamma 90 was a gift from Pietro De Camilli (Addgene plasmid # 22299; http://n2t.net/addgene:22299; RRID: Addgene_22299). GABA (A ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Cell Biology 2023Quote: ... Myo1c-K892A–GFP and Myo1c-R903A–GFP were kind gifts from Michael Ostap.21 PH-PLCδ1-GFP/RFP were gifts from Christian Halaszovich.32 GFP-PIPK1 gamma 87 was a gift from Pietro De Camilli (Addgene plasmid # 22300).33 VWF-GFP was a gift from J ...
-
bioRxiv - Immunology 2024Quote: ... The murine CD3 WTdelta-F2A-gamma-T2A-epsilon-P2A-zeta pMIA II plasmid was a gift from Dario Vignali (Addgene plasmid # 52093) [40] ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...