Labshake search
Citations for Addgene :
1 - 50 of 1488 citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Systems Biology 2022Quote: ... and lambda phosphatase were purchased from Addgene (Addgene Kit #1000000094)7.
-
bioRxiv - Molecular Biology 2019Quote: ... High-specificity variants of Cas9 — eSpCas9(1.1) (gift from F. Zheng, Broad Institiute; Addgene plasmid 71814) and VP12 (‘SpCas9-HF1’ ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Plant Biology 2022Quote: The longer and shorter transporter 3′ UTRs were cloned into the dual luciferase construct pGreen_dualluc_3′UTR_sensor at EcoRI sites (Addgene, Cat: 55206). The longer 3′ UTRs without AU-rich elements were amplified using flanking PCR methods ...
-
bioRxiv - Neuroscience 2020Quote: UAS-SMARCA1 construct: Flies carrying UAS-SMARCA1WT were generated using human SMARCA1 cloned into the pFastBac Dual vector (Addgene plasmid #102243). Gateway cloning (Invitrogen ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Excitatory specificity was ensured using either a cre dependent AAV (Syn-ChroME Addgene 170161; or CAG-ChroME2s Addgene 170163) in an excitatory specific cre line (Emx1-Cre ...
-
bioRxiv - Neuroscience 2022Quote: ... Excitatory specificity was ensured using either a cre dependent AAV (Syn-ChroME Addgene 170161; or CAG-ChroME2s Addgene 170163) in an excitatory specific cre line (Emx1-Cre ...
-
bioRxiv - Cell Biology 2023Quote: ... CRISPRi libraries (single CRISPRi-v2 library, Non-targeting dual library [Addgene #197348], or EMC2 dual library [Addgene #197349]) were transduced at a multiplicity of infection less than one into 300-330 million K562-CRISPRi-Tet-ON cells containing the appropriate reporter ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Biophysics 2020Quote: ... Dual transfections containing mCh-Drp1 (Addgene, plasmid #49152) and Mito-GFP (gift from Hari Shroff ...
-
bioRxiv - Genetics 2019Quote: ... plasmid pAC154-dual-dCas9VP160-sgExpression (Addgene plasmid # 48240)18 was linearized to introduce the 2A-GFP sequence downstream to the dCas9-VP160 fusion ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... we used a programmed dual sgRNA guide vector (Addgene #140096) (see table S8 for list of dual guide combinations and respective protospacer sequences) ...
-
bioRxiv - Genetics 2023Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722 ...
-
bioRxiv - Biochemistry 2024Quote: ... Lambda Phosphatase plasmid was ordered from Addgene (a gift from John Chodera & Nicholas Levinson & Markus Seeliger ...
-
bioRxiv - Genomics 2022Quote: The completed dual gRNA vector and pBFv-nosP-Cas9 (Addgene #138402) were purified and co-injected (BestGene Inc. ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... For editing of CD163 a dual guide RNA lentivirus (Addgene #67974) was modified to express the CD163 guides SL26 and SL2855 by cloning a gBlock containing the crRNASL26-tracrRNA-mU6-crRNASL28 sequence into the BbsI site ...
-
bioRxiv - Cell Biology 2022Quote: ... The dual-tag Galectin3 plasmid was acquired from Addgene (ref. 64149). The TBC1D15 coding sequence was subcloned into vectors pEGFPC1 and pGEX6P1 for expression in mammalian and bacterial cells ...
-
bioRxiv - Cell Biology 2023Quote: ... CRISPRi libraries (single CRISPRi-v2 library, Non-targeting dual library [Addgene #197348] ...
-
bioRxiv - Cell Biology 2024Quote: ... which were inserted into dual gRNA targeting vector pX333 (Addgene #64073). E14 ESCs were then transfected with 0.5µg of the targeting vector using Lipofectamine 3000 (Thermo Fisher Scientific-L3000001) ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Neuroscience 2019Quote: ... was generated via Gibson Assembly based on pmyo-3::QuasAr::mOrange and pPD96.52 (pmyo-3, Fire Lab Vector Kit, Addgene plasmid #1608), using restriction enzymes BamHI and XbaI and primers QUASAR_fwd (5’-cccacgaccactagatccatATGGTAAGTATCGCTCTGCAG-3’ ...
-
bioRxiv - Biophysics 2023Quote: ... The lambda Phosphatase plasmid was obtained from Addgene (a gift from John Chodera & Nicholas Levinson & Markus Seeliger ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9 fusion constructs were generated using pAC2-dual-dCas9VP48-sgExpression (Addgene, #48236) as a starting point ...
-
bioRxiv - Cell Biology 2023Quote: ... pCAS plasmid was constructed from a previous dual-Cas9 plasmid (Addgene #107320) by replacing the 3×HA sequence with a P2A sequence using Gibson assembly ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Cell Biology 2023Quote: (A) Dual-fluorescent reporter plasmid pFU-GW-sMYH6-mNeon-TNNT2-mScarlet (Addgene #170712). (B ...
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Cell Biology 2020Quote: ... human KLF4 (RRID:Addgene_17219), human c-MYC (RRID:Addgene_17220 ...
-
bioRxiv - Cell Biology 2020Quote: ... human SOX2 (RRID:Addgene_17218), human KLF4 (RRID:Addgene_17219) ...
-
bioRxiv - Neuroscience 2022Quote: ... human DNAJB4 (Addgene) and DNAJB6 (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... annealed and cloned into the dual Cas9 and sgRNA expression vector pX330 (Addgene, #42230) with BbsI sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmids were integrated via dual transfection with pCAG-SpCas9-GFP-U6-gRNA (Addgene: 79144) expressing a gRNA targeted the AAVS1 T2 site.
-
bioRxiv - Molecular Biology 2022Quote: pFastBac Dual His6 MBP N10 TEV LIC cloning vector (5C) was purchased from Addgene (Addgene plasmid no ...