Labshake search
Citations for Addgene :
1 - 50 of 2105 citations for Human Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Plasmids for lentiviral transduction (pLJM1-2xStrep or untagged wild-type ORF68, mutants, and homologs) (Addgene #x-x) were generated by subcloning into the AgeI and EcoRI sites of pLJM1 modified to confer resistance to zeocin (Addgene #19319 ...
-
bioRxiv - Biochemistry 2022Quote: ... For experiments in Drosophila a pUAST-attB plasmid encoding drosophila Src homolog isoform A (Src42A) was cloned by amplifying Src42A codifying sequence from a pGEX-Src42A donor plasmid (Addgene #126673) using primers with EcoRI (forward 5′-CTGAATAGGGAATTGGGAATTCATGGGTAACTGCCTCACC-3′ ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chimeras of the minimal domain (NTD) ORF24 homologs with ORF24 202-752 were generated using two-insert InFusion cloning (Addgene #138453-138455) into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag).
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x). Mutations in ORF68 (Addgene #x-x ...
-
bioRxiv - Biophysics 2019Quote: ... and human KIF1A (aa 1-393; Addgene # 61665). Tau-2N4R ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used human decipher module 1 library (RRID:Addgene_28289)(Diehl et al ...
-
bioRxiv - Immunology 2021Quote: Human SHP-1 wt cDNA was obtained from Addgene. The cDNA of SHP-1 was subcloned into the expression vector pEYFP-N1(Clontech ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Cell Biology 2020Quote: ... The Toronto human knockout pooled library (TKO) Version 1 (Addgene #1000000069) was a gift from Jason Moffat19.
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
bioRxiv - Cell Biology 2020Quote: ... human KLF4 (RRID:Addgene_17219), human c-MYC (RRID:Addgene_17220 ...
-
bioRxiv - Cell Biology 2020Quote: ... human SOX2 (RRID:Addgene_17218), human KLF4 (RRID:Addgene_17219) ...
-
bioRxiv - Neuroscience 2022Quote: ... human DNAJB4 (Addgene) and DNAJB6 (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: Human PARP6 (Uniprot #Q2NL67-1) was cloned into a modified pFASTBac1 vector (Addgene #30116) with N-terminal 6X His-maltose binding protein (MBP ...
-
bioRxiv - Neuroscience 2023Quote: ... human TDP-43M337V has subcloned into the pLenti CMV Puro DEST (W118-1, Addgene) plasmid as previously described (Zhang et al ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Molecular Biology 2023Quote: ... an shRNA targeting human UNK gene was cloned in the pLKO.1 puro plasmid (Addgene_8453) between AgeI and EcoRI sites61 ...
-
bioRxiv - Biophysics 2019Quote: ... human DCX (Addgene #83928), mouse DCLK1 (Transomics #BC133685) ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...