Labshake search
Citations for Addgene :
1 - 50 of 851 citations for Human Amyloid Beta 42 Abeta42 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Beta (Addgene # 170449), Gamma (Addgene # 170450) ...
-
bioRxiv - Bioengineering 2022Quote: pCMV-BE3 (Addgene #73021),34 pEF-BFP (Addgene #138272),42 pSP-gRNA (Addgene #47108),22 and pcDNA-dCas9,22 and PX552 (Addgene # 60958),60 were gifts from David Liu ...
-
bioRxiv - Cell Biology 2022Quote: ... subcloning from the following constructs: XLone-Axin-tdmRuby3 (above) and Human Beta-catenin GFP purchased from Addgene (#71367). The following primers were used ...
-
bioRxiv - Biochemistry 2020Quote: ... DGK beta (Addgene; 35405) were from Robert Lefkowitz and Stephen Prescott ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-42:AAVS1-mTagRFPT-CAAX (Addgene plasmid #107580 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pRR-Puro recombination reporter (42) (Addgene 65853) was co-transfected and 36 hours after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... IFN-Beta-pGL3 (Addgene 102597), or empty vector pcDNA3.1 (Life Technologies V79020 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Beta-Catenin-20 (Addgene plasmid 55001 ...
-
bioRxiv - Cell Biology 2020Quote: ... amplified from the pMSCV-IRES-hCD4plasmid (Addgene #35712 (42)) ...
-
bioRxiv - Neuroscience 2019Quote: ... 42] but using helper plasmids pCAG-B19N (Addgene #59924), pCAG-B19P (Addgene #59925) ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613 ...
-
bioRxiv - Biophysics 2023Quote: ... pET-Sac Aβ(M1–42) plasmid was obtained from ADDGENE and plasmid with Aβ mutant genes was subcloned at the molecular cloning facility at Florida State University.
-
bioRxiv - Cancer Biology 2021Quote: ... we used pLV-beta-catenin ΔN90 (Addgene, #36985) and pPRIME-CMV-NEO-recipient (CTRL ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used pXL002-ishRNA-beta-catenin-1 (Addgene, #36297) and pXL004-ishRNA-scramble (Addgene ...
-
bioRxiv - Microbiology 2019Quote: ... Transfection with GFP beta-actin (addgene #27123, Addgene, USA)(13 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plasmid E[beta]C (Addgene cat. no. 24312) was used ...
-
bioRxiv - Plant Biology 2021Quote: ... coli strains containing pAC-BETA-At (Addgene plasmid no. #53288), pAC-ZETA (Addgene plasmid no ...
-
bioRxiv - Systems Biology 2020Quote: ... lentiGuide-Puro plasmid (a gift from Feng Zhang, Addgene #52963, RRID: Addgene_137729 42) expressed sgRNA and pHAGE TRE-dCas9-VP64 plasmid (a gift from Rene Maehr & Scot Wolfe ...
-
bioRxiv - Systems Biology 2020Quote: ... lentiGuide-Puro plasmid (a gift from Feng Zhang, Addgene #52963, RRID: Addgene_137729 42) expressed sgRNA and pHAGE TRE-dCas9-VP64 plasmid (a gift from Rene Maehr & Scot Wolfe ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-42:AAVS1-mTagRFPT-CAAX (Addgene plasmid #107580; http://n2t.net/addgene:107580; RRID:Addgene_107580), AICSDP-1:PXN-EGFP (Addgene plasmid #87420 ...
-
bioRxiv - Cell Biology 2019Quote: ... EGFP-EPLIN beta - a gift from Elizabeth Luna (Addgene plasmid # 40948) - and pcDNA3-myc-FLNa WT - a gift from John Blenis (Addgene plasmid # 8982)(Woo et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mCherry-Beta-Catenin-20 (a gift from Michael Davidson; Addgene plasmid # 55001), and pcDNA3-S33Y Beta-catenin (a gift from Eric Fearon (Kolligs et al ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-42:AAVS1-mTagRFPT-CAAX was a gift from Allen Institute for Cell Science (Addgene plasmid # 107580 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017; http://n2t.net/addgene:54017; RRID:Addgene_54017) were gifts from Michael Davidson.
-
bioRxiv - Biochemistry 2022Quote: ER-mCherry (mCh-Sec61 beta) plasmid was a gift from Gia Voeltz (Addgene 49155) (37) ...
-
bioRxiv - Microbiology 2020Quote: ... pMch-sec61-beta shows ER and the ER-Golgi intermediate compartment (Addgene cat 49155) (40) ...
-
bioRxiv - Genomics 2021Quote: ... The plasmid pCI-neo beta catenin S33Y was a gift from Bert Vogelstein (Addgene plasmid # 16519 ...
-
bioRxiv - Immunology 2021Quote: ... MSCV-beta-catenin-IRES-GFP was a gift from Tannishtha Reya (Addgene plasmid #14717). MSCV-Cre-IRES-GFP was previously described [9] ...
-
bioRxiv - Microbiology 2024Quote: ... 20ng encoding firefly luciferase driven by an IFN-beta promoter (IFN-Beta_pGL3, Addgene 102597), 5ng of renilla luciferase (pRL-TK - Promega E2241) ...
-
bioRxiv - Molecular Biology 2019Quote: ... It was cloned into the pUC57-sgRNA expression vector (42) (a gift from Xingxu Huang; #51132, Addgene). The Cas9-VP12 vector (43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ITGB3 sequence (pcDNA3.1-beta-3 was a gift from Timothy Springer; Addgene plasmid # 27289) was subcloned into pLenti6.3/TO/V5-Blasti (A11144 ...
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Cell Biology 2020Quote: ... human KLF4 (RRID:Addgene_17219), human c-MYC (RRID:Addgene_17220 ...
-
bioRxiv - Cell Biology 2020Quote: ... human SOX2 (RRID:Addgene_17218), human KLF4 (RRID:Addgene_17219) ...
-
bioRxiv - Neuroscience 2022Quote: ... human DNAJB4 (Addgene) and DNAJB6 (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... Reduced Expression GFP beta actin was a gift from Rick Horwitz & Tim Mitchison (Addgene plasmid # 31502). In this plasmid the base pairs 91-544 of the enhancer region in the CMV promoter are deleted ...
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14754). Plasmids were purified from a host E ...
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-WT (HA GSK3 beta wt pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14753), GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett ...
-
bioRxiv - Neuroscience 2023Quote: ... and mutant variants of mouse p38γ were cloned into a pULTRA plasmid,42 a gift from Malcolm Moore (Addgene plasmid no. 24129; http://n2t.net/addgene:24129; RRID: Addgene_24129). To obtain WT p38γ ...
-
bioRxiv - Cancer Biology 2023Quote: HA-EZH2 plasmid mutant constructs were generated using site directed mutagenesis of pCMV-HA-EZH2 a gift from Kristian Helin (Addgene plasmid # 24230; http://n2t.net/addgene:24230; RRID:Addgene_24230 (42)) ...
-
bioRxiv - Genetics 2020Quote: pDEST-FLAG-HA-USP5 and pDEST-FLAG-HA-OTUD5 were gifts from Wade Harper (Addgene plasmids # 22590 and # 22610(42). OTUD5 patient mutations (G494S ...
-
bioRxiv - Neuroscience 2023Quote: Wild type (WT) and mutant variants of mouse p38γ were cloned into a pULTRA plasmid,42 a gift from Malcolm Moore (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2023Quote: ... The RNAi clone that targets the 3’UTR of CDC-42 was generated through amplification of genomic CDC-42 3’UTR (Fwd: gaagatctgaacgtcttccttgtctccatgt; Rev: ggggtaccacgtaacggtgtatccggac) and insertion into the L4440 plasmid (#1654 Addgene). Control bacteria is transformed with empty L4440 vector (#1654 Addgene).
-
bioRxiv - Microbiology 2019Quote: ... ADRB1 was amplified from pcDNA3 Flag beta-1-adrenergic-receptor (gift from Robert Lefkowitz; Addgene plasmid # 14698). All fragments contained ~20bp overhangs and were assembled into EcoRV cut pLenti CMV Puro DEST (w118-1 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...