Labshake search
Citations for Addgene :
1 - 50 of 1377 citations for Glyphosate Chemical Purity 96% 2 13C 99%; 15N 98%+ 1000 Ug Ml In Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 1 ug total DNA (0.5 ug PCR product and 0.5 ug AsCpf1_TATV Cas12 [Addgene: 89354]) using Xtreme-GENE 9 following manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 0.88 ug lentiviral transfer plasmid along with 0.66 ug pSPAX2 (Addgene plasmid #12260) and 0.44 ug pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Neuroscience 2020Quote: ... The (CGG)99 plasmid was obtained from Addgene and the (CTG)202 plasmid was a kind gift from Maurice Swanson ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Genomics 2020Quote: ... Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138) containing spCas9 and GFP ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 15 ug of psPAX2 (Addgene) were added into 3 ml OptiMEM (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.16 ug pMDLg/pRRE (Addgene #12251), 700 ng pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: Day 5 moDCs previously transfected with either NT or gal9 siRNA were transfected with 2 ug of the Str-KDEL_TNFα_SBP_EGFP plasmid (Addgene, #65278) (Boncompain et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3.2 ug pMD2.G (Addgene plasmid # 12259) and 10 ug of the plasmid of interest ...
-
bioRxiv - Bioengineering 2020Quote: ... 1.5 ug pCMV-PE2 plasmid (Addgene #132775), 500 ng pegRNA plasmid (cloned into Addgene #132777) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and one ug pMD2.G (Addgene #12259) into a 10-cm dish of 293FT cells (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: Three ug of pAAV2 vector (Addgene #89771) was digested with MluI/BstEII to release the insert between the two ITRs ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Immunology 2021Quote: ... and 0.44 ug pMD2.G (Addgene plasmid #12259), kind gifts from Didier Trono ...
-
bioRxiv - Cell Biology 2019Quote: ... 11.3 ug of each half library was co-transfected with 17 ug of psPAX2 (Addgene #12260, a gift from Didier Trono) and 11.3 ug of pCMV-VSV-G (addgene #8454 ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... pMD2.G and pRSV/Rev (2.88 ug total, Addgene) plus pMK1221-control or −GR shRNA (2.88 ug shCtrl or shGR ...
-
bioRxiv - Immunology 2023Quote: ... and 3.5 ug of PmD2.G (Addgene, Cat #12259) using Lipofectamine 2000 transfection reagent (Invitrogen cat # 11668019) ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Microbiology 2020Quote: ... 36 ug of pRSV-Rev packaging plasmid (containing Rev, Addgene), 18 ug of pMD2.g packaging plasmid (containing VSV-G envelope ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.25 ug of left and right AAVS1 TALEN plasmids (Addgene plasmid no ...
-
bioRxiv - Genomics 2020Quote: ... we used 40 ug p2T CBh Cas9 BlastR (Addgene 71489), 40 ug gRNA plasmid ...
-
bioRxiv - Immunology 2023Quote: ... 10 ug pRSV-Rev (kind gift from Didier Trono (Addgene plasmid #12253 ...
-
bioRxiv - Immunology 2023Quote: ... 15 ug pMDLg/pRRE (kind gift from Didier Trono (Addgene plasmid #12251 ...
-
bioRxiv - Microbiology 2020Quote: ... 90 ug of pMDLg/pRRE packaging plasmid (containing Gag & Pol, Addgene), 36 ug of pRSV-Rev packaging plasmid (containing Rev ...
-
bioRxiv - Microbiology 2020Quote: ... 18 ug of pMD2.g packaging plasmid (containing VSV-G envelope, Addgene). Transfection was performed using Lipofectamin 2000 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2021Quote: ... (a gift from Loren Looger, Addgene plasmid # 98929; http://n2t.net/addgene:98929; RRID:Addgene_98929; 1013 vg/mL in water) was injected into the vitreous humour of wild type mice (C57BL/6J ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus solution (1000 nl, titer ≥1013 vg/ml, #100836-AAV9 from Addgene) was injected in the SCN (ML +/-0.2 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of AAV9.hsyn.FLEX.iGluSnFR.WPRE.SV40 (a gift from Loren Looger, Addgene plasmid # 98931; http://n2t.net/addgene: 98931; RRID:Addgene_98931, 10 vg/mL in water) solution was injected with a blunt tip (30 gauge ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5ug of plasmid library was co-transfected with four ug PsPAX2 (Addgene #12260) and one ug pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2021Quote: ... Each transfection condition contained 0.5 ug of a plasmid encoding GCaMP6s (Addgene #40753) and 1.5 ug of the plasmid encoding the appropriate olfactory receptor ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 ug of DNA (the pegRNA plasmid and the pCMV-PE2 plasmid (Addgene #132775) at a 1:2 ratio by mass of pegRNA plasmid:PE2) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-flex-ChR2-Tdtomato (Addgene, titer 2*1012/ml, 0.5 μl) or AAV1-flex-ChR2-mCherry (Charite Vector core ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 96-140 (Addgene #213501), α-syn 96-140 Scr (Addgene #213502 ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of CROPseq-Guide-Puro (Addgene #86708) for 2 h at 37 °C with 2 ul of FastDigest Mph1103I (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSynapsin1-hM3D(Gq)-mCherry (Addgene, #50474, ≥ 2 x 1012 vg/ml) or AAV9-hSynapsin1-Lamp1-mScarlet-I (3.06 x1012 vg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2019Quote: ... 5.2×1012 gc/ml) and AAV2/5-hSyn-DIO-hM3Dq-mCherry (7.8×1012 gc/ml) were produced from Addgene plasmids #44362 and #44361 at the facility of Nantes University (UMR 1089 ...
-
bioRxiv - Genomics 2022Quote: sgRNA targeting the genomic region of integration was cloned in BbsI linearized pX335-U6-Chimeric_BB-CBh-hSpCas9n (99) (D10A) plasmid (Addgene #42335) using NEBuilder HiFi DNA Assembly Master Mix (1:3 molar ratio ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 96-140 Scr (Addgene #213502) and α-syn 96-110 Scr (Addgene #213503 ...
-
bioRxiv - Systems Biology 2022Quote: ... we first prepare the vector backbone by incubating 5 ug of PB-TRE-dCas9-VPR (Addgene #63800) for 2 h at 37°C with 2 ul of FastDigest FspAI (ThermoFisher cat ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...