Labshake search
Citations for Addgene :
1 - 50 of 924 citations for Galectin 9 Human HEK293 GST since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Biochemistry 2024Quote: An expression plasmid of human GST-Cdk2 was purchased from AddGene (plasmid #61845) and used without further subcloning ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells expressing human ACE2 (previously described20) were transduced with lentiviruses carrying dCAS9-10xGCN4 (Addgene 60903) termed HEK293-ACE2-SunTag ...
-
bioRxiv - Biochemistry 2024Quote: GST-CK2α and GST-CK2α′ expression vectors were purchased from Addgene (pDB1 #27083 and pDB6 #27084 ...
-
bioRxiv - Cell Biology 2022Quote: ptf-Galectin-3 was a gift from Tamotsu Yoshimori (Addgene plasmid # 64149) (Maejima et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 C-terminal half (GST-LIC 389-523) was a gift from Ron Vale (Addgene plasmid #74599 ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ...
-
bioRxiv - Cancer Biology 2022Quote: ... GST-YAP2 (Addgene #24637), pCMV-FLAG-YAP-5SA/S94A (Addgene #33103) ...
-
bioRxiv - Cell Biology 2023Quote: ... GST-TEV-ATG101 (RRID:Addgene_171414). On the other hand ...
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... GST-Rap2b and GST-Rap2c pGEX-2T plasmids were purchased from Addgene (#55667 and #55668, respectively). For mCherry-Rap2a ...
-
bioRxiv - Biochemistry 2023Quote: ... GST–TEV–FUS (Addgene, Plasmid #29629), pDEST_TAF15 (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Cell Biology 2023Quote: Linear tetra-ubiquitin fused to GST (GST-4×Ub) was cloned into a pGEX-4T1 vector (RRID:Addgene_199779). After the transformation of the pGEX-4T1 vector encoding GST-4×Ub in E ...
-
bioRxiv - Genetics 2022Quote: ... subcloned first in the pRK5 plasmid containing the GST tag sequence (Addgene, pRK5-HA GST RagC wt, #19304) at the N-terminal by using SalI and NotI restriction enzymes to replace RagC with PUM1 ...
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Microbiology 2021Quote: ... pet41s GST ATF6αTAD (aa 1-150) (Addgene) contained the TAD domain.
-
bioRxiv - Plant Biology 2023Quote: ... the vectors pET-GST (Addgene No. 42049) and pET-15b were employed ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/9 (Addgene #112865), or rAAV2-retro (Addgene #81070 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV2/1.ef1a.fDIO.GCaMP6s (Janelia Vector Core) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/9 (Addgene #112865), or pUCmini-iCAP-PHP.eB (Addgene #103005) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (Addgene #112865), pAAV-hSyn-Cre (Addgene #170367)61 ...
-
bioRxiv - Cancer Biology 2021Quote: Galectin-3 cDNA was subcloned into the pMIG-GFP retroviral expression vector (plasmid #9044, AddGene, Cambridge, MA). Stably transduced hGalectin-3 expressing OP9 cells were generated by infecting cells with retroviral particles and FACS sorting of GFP expressing (positively transduced ...
-
bioRxiv - Microbiology 2023Quote: Plasmids expressing GST-RILP (obtained from Christopher Burd, Yale University) or GST alone (from pGEX KG vector; Addgene #77103) were transformed into Escherichia coli strain BL21(DE3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and TopBP1 was produced as a fused protein with a GST-tag (GST TopBP1 (aa 32-1522) His from Addgene; plasmid # 20375) ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... pRK5-HA GST RagA_Q66L (RagAGTP; Addgene plasmid # 19300), pRK5-HA GST RagB T54L (RagBGDP ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV2/9 Helper (Addgene, #112867), and pAd-deltaF6 (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... 9 µg psPAX2 (Addgene #12260), and 12 µg pLKO.1 transfer vector using Lipofectamine 2000 (Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... psPAX2 (Addgene 12260, 9 µg), the guide containing vector (pXPR_066 ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... pRK5-HA GST RagD S77L (RagDGDP; Addgene plasmid # 19308), pRK5-HA GST RagD Q121L (RagDGTP ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... pRK5-HA GST RagB Q99L (RagBGTP; Addgene plasmid # 19303), pRK5-HA GST RagC S75L (RagCGDP ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... pRK5-HA GST RagB T54L (RagBGDP; Addgene plasmid # 19302), pRK5-HA GST RagB Q99L (RagBGTP ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... pRK5-HA GST RagD Q121L (RagDGTP; Addgene plasmid # 19309). For all Rag constructs similar levels of transfection efficiency were achieved with ~75% of cells expressing 48 hours after transfection ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... pRK5-HA GST RagC S75L (RagCGDP; Addgene plasmid # 19305), pRK5-HA GST RagC Q120L (RagCGTP ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... pRK5-HA GST RagC Q120L (RagCGTP; Addgene plasmid # 19306), pRK5-HA GST RagD S77L (RagDGDP ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus glutathione S-transferase (GST; RRID:Addgene_29707); N-terminal His6 plus small ubiquitin-like modifier (SUMO ...
-
bioRxiv - Neuroscience 2022Quote: ... The vector backbone AIRAP9-PSMD2-GST (Addgene no. 21799), was digested using HinDIII and XhoI to remove the PSMD2 CDS and the amplified Zic3 gene was cloned using Infusion kit (Clontech ...
-
bioRxiv - Cell Biology 2023Quote: ... pET-His-GST-tev-LIC (Addgene #29655, Gradia Lab), pGEX-4T-3-mR7BD (Addgene #79149 ...