Labshake search
Citations for Addgene :
1 - 50 of 932 citations for Galectin 14 LGALS14 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were transfected with pFlagCMV2-14-3-3sigma (Addgene, Cambridge, MA, Plasmid #12453) (68) ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells expressing human ACE2 (previously described20) were transduced with lentiviruses carrying dCAS9-10xGCN4 (Addgene 60903) termed HEK293-ACE2-SunTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Cell Biology 2022Quote: ptf-Galectin-3 was a gift from Tamotsu Yoshimori (Addgene plasmid # 64149) (Maejima et al. ...
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309 ...
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Neuroscience 2020Quote: ... pEZYmyc-His (Addgene plasmid #18701 ...
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Cancer Biology 2021Quote: Galectin-3 cDNA was subcloned into the pMIG-GFP retroviral expression vector (plasmid #9044, AddGene, Cambridge, MA). Stably transduced hGalectin-3 expressing OP9 cells were generated by infecting cells with retroviral particles and FACS sorting of GFP expressing (positively transduced ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... pEZYmyc-HIS (Addgene, #18701) or pDEST-myc ...
-
bioRxiv - Cancer Biology 2022Quote: ... ITGA2-HIS (Addgene, #51910), ITGB2-YFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... his-hOPTN (Addgene, #23053), mOPTN (mouse tissue cDNA) ...
-
bioRxiv - Cell Biology 2024Quote: ... Eps15-GFP-His (Addgene #170860 ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... TadA8e (Addgene #138489)14 and Tad8.20m (Addgene #136300)50 were PCR amplified and inserted into empty entry vectors by Gibson assembly.
-
bioRxiv - Immunology 2021Quote: ... The human full length (HFL) gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537 ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were transfected with pMIB1-FLAG (Addgene# 37116) and pHA-Ub (Addgene# 18712 ...
-
bioRxiv - Systems Biology 2021Quote: ... The pMEL16 (His-, Addgene 107922) and p414-TEF1p-Cas9-CYC1t (hereafter referred to as P414 ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID ...
-
bioRxiv - Bioengineering 2023Quote: HIS-tagged HER2 (Addgene #16257) was expressed using the Expi293™ expression system (Thermo Fisher ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Cell Biology 2022Quote: HEK293 cell were transfected with pGL3BRE Luciferase (#45126, Addgene®) and pCMV-Renilla luciferase plasmid (Thermofisher #16153) ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were electroporated with plasmid DNA pcDNA3.1/Zeo(+) (Addgene) containing only the Strep-Flag (SF)-tag (mock) ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293 cells transfected with either cmv-gfp (control; Addgene 11153) or cmv-CAPS-FLAG were plated in a 96-well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... pcDNA3.1-Flag-His-ATM (Addgene 31985), pcDNA3.1-mCherry-NLRP3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SERPINE1-bio-his (Addgene #52077) which were gifts from Gavin Wright without signal sequence to prevent cleavage of fused proteins (75) ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139113)
-
bioRxiv - Developmental Biology 2021Quote: pET-28b-RfxCas13d-His (Addgene #141322) plasmid containing the T7 promoter was linearized by using NotI restriction site ...
-
bioRxiv - Developmental Biology 2023Quote: ... pcDNA3.0-BMAL1-His (AddGene CN: 31367), pcDNA3.0-3XFLAG-Cry2 plasmids and PEI max 40k (Polysciences Inc CN ...
-
bioRxiv - Developmental Biology 2023Quote: pcDNA3-BMAL1-His (AddGene CN: 31367) were purchased from the Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid #54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid #54560 ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid#54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid#54560 ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald-MyosinIIA-N-14 (Addgene plasmid #54191) and mApple-LC-myosin-C-10 (Addgene plasmid #54919 ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK293 cells were transfected with 3.0ug pcDNA3.1-hACE2 (Addgene, 145033, USA) plasmids by Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293 cells were transfected with PPRE-H2b-eGFP (59) (Addgene #84393) using Invitrogen Lipofectamine 3000 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... of the parental cells (HEK293) with lentiCRISPR v2 plasmid57 (Addgene #52961) containing target specific gRNAs listed in Methods Table 1 ...