Labshake search
Citations for Addgene :
1 - 50 of 105 citations for Dopamine Transporter Rat Monoclonal DAT ECD biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... DAT-HA was amplified from RFP-HA-DAT (Addgene, 90265) using ECoR-I and Xba-I sites and subcloned into the same backbone as the DAT-pH ...
-
bioRxiv - Neuroscience 2023Quote: Rats were infused bilaterally with AAV encoding the GPCR-activation-based dopamine sensor GRABDA2h (pAAV9-hsyn-GRAB_DA2h, Addgene) or control fluorophore (AAV8-hSYN-GFP) ...
-
bioRxiv - Neuroscience 2023Quote: ... FLAG-CDKL5 and dopamine D2 receptor (gfp-DRD2, Addgene) were co-transfected at a ratio of 2:0.75:1.
-
bioRxiv - Neuroscience 2022Quote: Human DAT cDNA was amplified from YFP-hDAT (Addgene, 90228) and pHluorin was amplified from vGlut1-pHluorin (a gift from Timothy A ...
-
bioRxiv - Neuroscience 2023Quote: We used fiber photometry and the GRABDA dopamine sensor (AddGene #140554) to measure dopamine activity during the task ...
-
bioRxiv - Neuroscience 2023Quote: ... dopamine was recorded with a red fluorescent GRABDA sensor (AddGene #140557AAV9-hSyn-GRAB rDA1h), while VTA DA terminals in the NAcc were stimulated for the approximate duration of the offer cue (500-600 ms) ...
-
bioRxiv - Neuroscience 2020Quote: ... ChAT-cre/DAT-cre trans-heterozygotes were injected with AAV2.5 Syn-Flex-GCaMP6s (Addgene 100843) in the left HDB and either AAV2.5 Syn-Flex-NES-jRGECO1a (Addgene 100853 ...
-
bioRxiv - Neuroscience 2022Quote: ... DAT-IRES-Cre mice (RRID: IMSR_JAX:027178) were injected with AAV1-CAG-FLEX-GCaMP6f virus (RRID: Addgene_100835). For labelling of SNc Anxa1+ neurons ...
-
bioRxiv - Neuroscience 2023Quote: Viral vectors encoding the fluorescent dopamine indicator dLight1.2 (AAV5-hSyn-dLight1.2) (Addgene, titer ≥ 4×10¹² vg/mL) and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40 ...
-
bioRxiv - Neuroscience 2021Quote: ... For fiber photometry recordings wildtype mice were injected into the NAc with an AAV encoding the dopamine sensor dLight (AAV2.5-CAG-dLight1.1, Addgene). Afterwards a gradient refractive index (GRIN ...
-
bioRxiv - Biophysics 2023Quote: ... biotin ligase (BirA; Addgene#109424) was expressed in E ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814; http://n2t.net/addgene:32814; RRID:Addgene_32814). The cDNA was subcloned into pcDNA3 between KpnI and XbaI restriction sites and under the T7 promoter for expression in Xenopus laevis oocytes ...
-
bioRxiv - Plant Biology 2022Quote: The longer and shorter transporter 3′ UTRs were cloned into the dual luciferase construct pGreen_dualluc_3′UTR_sensor at EcoRI sites (Addgene, Cat: 55206). The longer 3′ UTRs without AU-rich elements were amplified using flanking PCR methods ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding human DAT (synthetic gene kindly provided by Dr. Jonathan Javitch, Columbia University, NY, USA61 was inserted into pmEOS2-C1 (RRID: Addgene#54510) to generate pmEOS2-hDAT C1 encoding hDAT with mEOS2 fused to the N-terminus ...
-
bioRxiv - Systems Biology 2019Quote: P(dat-1)::YFP and P(dat-1)::alpha-Synuclein-YFP were generated by cloning the P(dat-1) promoter in the plasmids pRP2386 28 and pPD30.38 (Addgene plasmid # 1443) respectively ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sequence encoding the native signal peptide and ECD of GPR56 (amino acids 1-400) was subcloned from pCAG-hGPR56-IRES-GFP (from Christopher A Walsh, Addgene 52297) into pCEP4 (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... eGFP expression was driven in DAT+ neurons by an AAV1:CAG:FLEX-eGFP vector (UPenn [Addgene], cat. no. AV-1-ALL854 [51502-AAV1]). For in-vivo fiber photometry of dopamine release (Fig ...
-
bioRxiv - Neuroscience 2020Quote: ... bacterial biotin ligase BirA-ER from Addgene #20856 was subcloned into a CFP-P2A expressing shuttle vector to form f(syn)CFP-P2A-BirA-ER ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat Myo1b (Plasmid #135064, Addgene) C-terminal Myc-tag ...
-
bioRxiv - Neuroscience 2024Quote: ... Opto-labeled dmPFC MP neurons were labeled with pAAV-CAG-hChR2-mcherry24 (Addgene viral prep # 28017-AAVrg) injected into motor cortex (A-P -0.6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The expression of Biotin ligase BirA from pTP264 (Addgene #149334) was carried out as described before (Pleiner et al. ...
-
bioRxiv - Biophysics 2023Quote: ... coli biotin ligase BirA from the T7 promoter (Addgene#109424) in E ...
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Neuroscience 2020Quote: ... Presynaptic rat neurexin1a was obtained from Addgene #58266 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Biophysics 2022Quote: ... and pET21a-BirA (Biotin Ligase) was a gift from Alice Ting (Addgene plasmid # 20857 ...
-
bioRxiv - Biophysics 2022Quote: ... mitochondria labeled by mEmerald-Tomm20-C-10 (Addgene, 54281), Golgi apparatus labeled by GalT-GFP (plasmid was a gift from the Patterson Lab ...
-
bioRxiv - Cell Biology 2023Quote: ... AP2µ2(rat)-mCherry was obtained from Addgene (#27672).
-
bioRxiv - Biophysics 2022Quote: ... Cell endoplasmic reticulum (ER) was labeled by ERmoxGFP (Addgene, 68072), mitochondria labeled by mEmerald-Tomm20-C-10 (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Mitochondria mCherry fluorescent-labeled marker (mCherry-Mito) was obtained from Addgene plasmid repository #55146 ...
-
bioRxiv - Neuroscience 2022Quote: ... rats received injections of AAV5.CMV.HI.eGFP-Cre.WPRE.SV40 (Addgene #105545, 0.3μl). In the Pf (females ...
-
bioRxiv - Neuroscience 2021Quote: ... hSS were labeled with AAV-DJ-mDlx-GCaMP6f-Fishell-2 (Addgene, 83899) and placed in a well of a Corning 96-well microplate (Corning ...
-
bioRxiv - Neuroscience 2019Quote: ... we labeled interneurons by injecting AAV8-hDLX-GqDREADD-tdTomato (plasmid from Addgene; virus packaged at Boston Children’s Hospital viral core) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were labeled with mCherry using the pLV-mCherry vector (Addgene, 36084). EZ-Tet-pLKO- Puro was a gift from Cindy Miranti (Frank et al ...
-
bioRxiv - Cell Biology 2020Quote: Mammalian expression plasmids encoding rat LAMP1 (mCherry-Lysosomes-20, Addgene; 55073), mApple-LAMP1-pHluorin (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... excitatory and inhibitory neurons were labeled by transfection with CaMKII-eGFP (Addgene, 50469) and GAD1-mCherry (Genecopoeia ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP ...
-
bioRxiv - Molecular Biology 2019Quote: ... A lentivirus construct containing the biotin ligase BirA was generated from the lentiCRISPR v2 backbone (Addgene 52961)[61] and a construct containing BirA (a gift from Mauro Modesti ...
-
bioRxiv - Neuroscience 2022Quote: ... ChAT-Cre or WT rats were injected with pAAV5-hSyn-mCherry (Addgene) at a titer of 1.4-2.8×1013 GC/mL.
-
bioRxiv - Cell Biology 2020Quote: ... pWC223 encoding the motor domain of Drosophila kinesin 1 fused to BCCP (noted Kin1-biotin) was a gift from Jeff Gelles (Addgene plasmid # 15960; http://n2t.net/addgene:15960; RRID:Addgene_15960).
-
bioRxiv - Neuroscience 2022Quote: ... Rats in control groups received either rAAV5/hSyn-DIO-mCherry (Addgene #50459, 0.75μl), saline (1.2μl ...
-
bioRxiv - Cancer Biology 2024Quote: ... DIV6 rat cortical neurons were treated with AAV-mDlx-NLS-mRuby (Addgene #99130) at a titer of >1x109 vg/ml.121 AAV-mDlx-NLS-mRuby2 was a gift from Viviana Gradinaru (Addgene plasmid #99130 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the ORFs were cloned into plasmid H6-mCerulean (pET Biotin His6 TEV mCerulean LIC cloning vector, Addgene plasmid #29726). In the second step ...
-
bioRxiv - Cell Biology 2021Quote: GFP-labeled versions of dominant negative Rab14 mutant were from Addgene (Cat#49594 and 49593). GFP-hRab21(T31N ...
-
bioRxiv - Neuroscience 2020Quote: ... a transfer plasmid containing rat Synapsin promoter and cDNA encoding GCaMP6s (Addgene plasmid #40753) was assembled and transfected with helper-free DJ plasmids (Cell Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... ChAT-Cre or WT rats were injected with pAAV5-hSyn-hM3D(Gq)-mCherry (Addgene) at a titer of 1.5×1013 GC/mL ...