Labshake search
Citations for Addgene :
1 - 50 of 681 citations for Diazinon Unlabeled 1000 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 1 ug total DNA (0.5 ug PCR product and 0.5 ug AsCpf1_TATV Cas12 [Addgene: 89354]) using Xtreme-GENE 9 following manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... 0.88 ug lentiviral transfer plasmid along with 0.66 ug pSPAX2 (Addgene plasmid #12260) and 0.44 ug pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Genomics 2020Quote: ... Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138) containing spCas9 and GFP ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 15 ug of psPAX2 (Addgene) were added into 3 ml OptiMEM (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.16 ug pMDLg/pRRE (Addgene #12251), 700 ng pMD2.G (Addgene #12259 ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... unlabeled HeLa-TDS cells were transfected with CENP-B-INCENP-GFP (Addgene, plasmid #45238), and for live-cell imaging also with mCherry-PRC1 plasmid provided by Casper C ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3.2 ug pMD2.G (Addgene plasmid # 12259) and 10 ug of the plasmid of interest ...
-
bioRxiv - Bioengineering 2020Quote: ... 1.5 ug pCMV-PE2 plasmid (Addgene #132775), 500 ng pegRNA plasmid (cloned into Addgene #132777) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and one ug pMD2.G (Addgene #12259) into a 10-cm dish of 293FT cells (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: Three ug of pAAV2 vector (Addgene #89771) was digested with MluI/BstEII to release the insert between the two ITRs ...
-
bioRxiv - Immunology 2021Quote: ... and 0.44 ug pMD2.G (Addgene plasmid #12259), kind gifts from Didier Trono ...
-
bioRxiv - Cell Biology 2019Quote: ... 11.3 ug of each half library was co-transfected with 17 ug of psPAX2 (Addgene #12260, a gift from Didier Trono) and 11.3 ug of pCMV-VSV-G (addgene #8454 ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... pMD2.G and pRSV/Rev (2.88 ug total, Addgene) plus pMK1221-control or −GR shRNA (2.88 ug shCtrl or shGR ...
-
bioRxiv - Immunology 2023Quote: ... and 3.5 ug of PmD2.G (Addgene, Cat #12259) using Lipofectamine 2000 transfection reagent (Invitrogen cat # 11668019) ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Microbiology 2020Quote: ... 36 ug of pRSV-Rev packaging plasmid (containing Rev, Addgene), 18 ug of pMD2.g packaging plasmid (containing VSV-G envelope ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.25 ug of left and right AAVS1 TALEN plasmids (Addgene plasmid no ...
-
bioRxiv - Genomics 2020Quote: ... we used 40 ug p2T CBh Cas9 BlastR (Addgene 71489), 40 ug gRNA plasmid ...
-
bioRxiv - Immunology 2023Quote: ... 10 ug pRSV-Rev (kind gift from Didier Trono (Addgene plasmid #12253 ...
-
bioRxiv - Immunology 2023Quote: ... 15 ug pMDLg/pRRE (kind gift from Didier Trono (Addgene plasmid #12251 ...
-
bioRxiv - Microbiology 2020Quote: ... 90 ug of pMDLg/pRRE packaging plasmid (containing Gag & Pol, Addgene), 36 ug of pRSV-Rev packaging plasmid (containing Rev ...
-
bioRxiv - Microbiology 2020Quote: ... 18 ug of pMD2.g packaging plasmid (containing VSV-G envelope, Addgene). Transfection was performed using Lipofectamin 2000 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus solution (1000 nl, titer ≥1013 vg/ml, #100836-AAV9 from Addgene) was injected in the SCN (ML +/-0.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5ug of plasmid library was co-transfected with four ug PsPAX2 (Addgene #12260) and one ug pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2021Quote: ... Each transfection condition contained 0.5 ug of a plasmid encoding GCaMP6s (Addgene #40753) and 1.5 ug of the plasmid encoding the appropriate olfactory receptor ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 ug of DNA (the pegRNA plasmid and the pCMV-PE2 plasmid (Addgene #132775) at a 1:2 ratio by mass of pegRNA plasmid:PE2) ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of CROPseq-Guide-Puro (Addgene #86708) for 2 h at 37 °C with 2 ul of FastDigest Mph1103I (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Systems Biology 2022Quote: ... we first prepare the vector backbone by incubating 5 ug of PB-TRE-dCas9-VPR (Addgene #63800) for 2 h at 37°C with 2 ul of FastDigest FspAI (ThermoFisher cat ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...
-
bioRxiv - Immunology 2021Quote: ... 80% confluent) were co-transfected with 2.4-ug of pLenti-pLex307-ACE lentiviral transfer plasmid (Addgene: 158448), 0.8-ug of pVSV-G ...
-
bioRxiv - Microbiology 2023Quote: ... was combined with 1 ug lenti CRISPR V2 plasmid (a gift from Feng Zhang, Addgene plasmid #52961) expressing the guide RNA (gRNA ...
-
bioRxiv - Immunology 2023Quote: ... 10 ug pRSV-Rev (kind gift from Didier Trono (Addgene plasmid #12253; http://n2t.net/addgene:12253; RRID:Addgene_12253), 15 ug pMDLg/pRRE (kind gift from Didier Trono (Addgene plasmid #12251 ...
-
bioRxiv - Immunology 2023Quote: ... 15 ug pMDLg/pRRE (kind gift from Didier Trono (Addgene plasmid #12251; http://n2t.net/addgene:12251; RRID:Addgene_12251), and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 200 uL of OptiMEM with 0.8 ug of the I-SceI expression plasmid (pCBASce, Addgene #60960). The media was replaced the next morning and the cells were trypsinized 48-hours post-transfection for analysis of GFP expression by flow cytometry (BD Biosciences).
-
bioRxiv - Microbiology 2022Quote: ... 2.54 ug of the VSV-G expression plasmid pMD2.G (a gift from Didier Trono, Addgene plasmid # 12259), and 6.42 ug of the appropriate helper construct (pHit-CMV-GagPol (55 ...
-
bioRxiv - Genomics 2023Quote: AAV production was performed by transfecting 293FT cells with 22 ug of pDGM6 helper plasmid (Addgene plasmid # 110660), 6 ug of donor template plasmid ...
-
bioRxiv - Cell Biology 2023Quote: Day 5 moDCs previously transfected with either NT or gal9 siRNA were transfected with 2 ug of the Str-KDEL_TNFα_SBP_EGFP plasmid (Addgene, #65278) (Boncompain et al ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454) using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Biophysics 2023Quote: ... total transfected DNA mass was kept at 10 ug for each condition using empty pBSK vector (Addgene # 212205). 500 ul Opti-MEM medium containing 20 ul Lipofectamine 3000 reagent was subsequently added to the plasmid containing mixture and incubated at RT for 15 mins ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 7.5 ug of the Human Improved Whole-Genome Knockout CRISPR library V1 (by Kosuke Yuya, Addgene #67989), 18.5 ug of psPax2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 800-1000 nL of a AAV5-hSyn-dLight1.2 vector (~1 × 1013 viral genomes/mL, obtained from Addgene; catalog #AAV5-111068) was delivered into the LNAc (antero-posterior ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Cancer Biology 2019Quote: ... 293T cells were plated at 1.5×106 cells confluency in 10 cm plates and they were transfected using calcium phosphate (2M CaCL2 and Hepes Buffered Saline) with 6.4 ug of psPAX2 (Addgene plasmid # 12260), 3.2 ug pMD2.G (Addgene plasmid # 12259 ...