Labshake search
Citations for Addgene :
1 - 50 of 346 citations for Cytomegalovirus Glycoprotein B gB Mouse Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... pSBtet-GB (Addgene #60504), gRNA-Cloning vector (Addgene #41824) ...
-
bioRxiv - Cell Biology 2022Quote: ... GB was PCR amplified from GB-NES (gift from R. Campbell, Addgene plasmid #61017) (Ding et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and pSBTet-GB were a gift from Eric Kowarz (Addgene plasmid # 60513 ...
-
bioRxiv - Neuroscience 2023Quote: ... and VSV g-glycoprotein Env (pMD2.G Addgene: 12259), together with pLentiRhoA2G (Addgene ...
-
bioRxiv - Biochemistry 2021Quote: ... and pMD2.G envelope glycoprotein vector (Addgene cat no. 12259) into HEK293 cells using Lipofectamine 2000 and maintained in DMEM supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2019Quote: Mouse SEMA6A-Fc and SEMA6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively) and human SEMA6A was gene-synthesized (GeneArt) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mouse Sema6a-Fc and Sema6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively). Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript) ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(mouse) is available from Addgene; #190691 ...
-
bioRxiv - Neuroscience 2020Quote: ... and the VSVG envelope glycoprotein vector pMD2-G (Addgene plasmid #12259) into HEK293T cells ...
-
bioRxiv - Cell Biology 2023Quote: ... RA-Sec61β and GB-Dcp1 were gifts from Gia Voeltz (Addgene plasmid #153978, #153979). Halo-OSBP was created by amplifying OSBP from pLJM1-FLAG-GFP-OSBP (Addgene #134659 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat Nfasc gene expressed from the cytomegalovirus (CMV) promoter (a gift from Vann Bennett, Addgene plasmid # 31061; http://n2t.net/addgene:31061; RRID: Addgene_31061) (Zhang et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Vesicular Stomatitis Virus glycoprotein (VSV-G) envelope expression vector (pMD2.G; Addgene #12259), lentiviral packaging plasmid (psPax2 ...
-
bioRxiv - Neuroscience 2022Quote: ... This construct was generated from a plasmid that contained a wild-type (WT) rat Nfasc gene expressed from the cytomegalovirus (CMV) promoter (a gift from Vann Bennett, Addgene plasmid # 31061 ...
-
bioRxiv - Neuroscience 2023Quote: ... with the SAD B19 glycoprotein gene from pCAG-B19G (Chatterjee et al., 2018) (Addgene 59921) and either the mCre ...
-
bioRxiv - Molecular Biology 2020Quote: ... The GFP nanobody-Fc fusion construct (pGEMHE-vhhGFP4-hIgG1-Fc; Addgene #105576) was described previously (Clift et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The gp67-438-B modified from 438-B (Addgene) was used to express recombinant secretory proteins.
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids encoding the spike glycoprotein of vesicular stomatitis virus (VSV-G) and Cas9 were obtained from Addgene (cat ...
-
bioRxiv - Neuroscience 2022Quote: ... and IgG2a Fc (Addgene #114492), were amplified and extracted similarly ...
-
bioRxiv - Neuroscience 2020Quote: ... engineered and optimized glycoprotein (oG) [76] sequence was ligated to pAAV-FLEX sequence from pAAV-FLEX-GFP (Addgene).
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral packaging plasmid psPAX2 and pMD2.G encoding the vesicular stomatitis virus glycoprotein were gifts from Didier Trono (Univ. of Geneva) and purchased from Addgene (http://n2t.net/addgene:12260 and http://n2t.net/addgene:12259 ...
-
bioRxiv - Immunology 2020Quote: ... pCMV-VSV-G plasmid encoding for the vesicular stomatitis virus glycoprotein was a gift from Bob Weinberg (Addgene plasmid #8454). LeGO-G2 ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or ddGFP-B (Addgene, 40287). cDNAs for the PAR binding domains were amplified from previously published pET19b constructs (Gibson et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509 ...
-
bioRxiv - Immunology 2024Quote: ... and B (AUC = 0.61, Addgene) respectively (Fig S10i) ...
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Neuroscience 2023Quote: ... Neuro2a cells stably expressing the CVS-N2c glycoprotein (N2A-N2cG_02 cells) were transfected with the barcoded N2c library along with helper plasmids pCAG-N2cN (Addgene cat. # 100801), pCAG N2cP (Addgene cat ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Pathology 2020Quote: ... Lentiviral vector pLV-mCherry and vesicular stomatitis virus glycoprotein (VSV-G) expression vector pMD2.G were obtained from Addgene (Watertown, MA, USA). Coding sequence of SARS-CoV-2 S gene (GenBank ...
-
bioRxiv - Biophysics 2023Quote: ... 3C protease site cloned into a pcDNA3 vector containing human IgG Fc derived from pcDNA3-Nrxn1beta AS4(-)-Fc (a gift from Peter Scheiffele & Tito Serafini, Addgene plasmid # 59313 ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... United States).62,63 Plasmid constructs pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-sACE2-T92Q-Fc(IgG1) were obtained from Addgene (United States). The N322Q mutation was introduced into ACE2-wt-Fc and ACE2-T92Q-Fc using the QuikChange Lightning Site-Directed-Mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... PMCA2w/b and GCamP6s (both from Addgene); and DsRedExpress2 (Clontech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HiFi SpCas9 (#) HypaR-SpCas9 (Addgene #126757), B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Cell Biology 2023Quote: ... and pUC57-b-globin (Addgene plasmid 194437) have been deposited at Addgene.
-
bioRxiv - Microbiology 2023Quote: ... and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFPC1-hVAP-B KD/MD (Addgene – 104450), pEFIRES-P-mTagBFP-KDEL (Addgene – 87163 ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ...
-
bioRxiv - Bioengineering 2021Quote: ... and B-GECO was also obtained from Addgene. MaLionG and mitoMaLionR were generated in the author’s group (T ...
-
bioRxiv - Biochemistry 2022Quote: ... expression plasmid was cloned by PCR amplification from full length ScTop2 12URA-B vector followed by insertion into a modified 1-B (Addgene #29653) E ...
-
bioRxiv - Bioengineering 2020Quote: ... and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183) were obtained as gifts from Erik Procko ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and pSH-EFIRES-B-Seipin-miniIAA7-mEGFP (Addgene #129719) [3,10] ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(chicken) is available from Addgene; #190692.
-
bioRxiv - Neuroscience 2023Quote: ... The desired region of plasmid pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) was amplified by PCR ...