Labshake search
Citations for Addgene :
1 - 16 of 16 citations for Cyclin B1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... cDNAs encoding either APC/C resistant (APC/CR) mVenus-cyclin A2 or mVenus-cyclin B1 were cloned into pINDUCER20 (plasmid #44012; Addgene) by replacing the gateway cassette sequence and were synthesized by Twist Biosciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cyclin D3 cDNA was cloned out of Rc/CMV cyclin D3 (CMV promoter; #10912 from Addgene) with PCR using the primers listed in Table 1 and cloned into pmCherry-C1 (CMV promoter ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-APEX plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and APEX from pcDNA3 APEX-nes (Addgene) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs encoding cyclin D1 WT and cyclin D1 (T286A) were PCR amplified from pcDNA cyclinD1 HA and pcDNA cyclinD1 HA T286A (Addgene plasmids #11181 and # 11182 ...
-
bioRxiv - Cell Biology 2020Quote: ... Plexin B1 cytoplasmic tail (aa 1512-2135) (PLXNB1, Addgene 25252), mouse Roundabout homolog 1 cytoplasmic tail (aa 880-1612 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pInducer20 empty vector and pInducer20 Cyclin E1 plasmids were obtained from Addgene. The FANCJ K/O U2OS cells complemented with FANCJ WT or FANCJS990A were further infected with the respected virus to express the empty vector or Cyclin E1 in a doxycycline inducible manner ...
-
bioRxiv - Cancer Biology 2023Quote: ... and MIGR1-Cyclin E-AA (Addgene #47498, a gift from Alex Minella)67 for expressing the mutant Cyclin E ...
-
bioRxiv - Biophysics 2021Quote: ... The mCherry-lamin B1-10 was a gift from Michael Davidson (Addgene plasmid #55069). GFP-tagged rat connexin-43 was generated earlier [25] ...
-
bioRxiv - Molecular Biology 2020Quote: ... expressed from separate promoters (pDual SR-B1 or CD81, available from Addgene: https://www.addgene.org/Joe_Grove/). Supernatants containing viral vectors were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Rc-CMV-Cyclin E (#8963) and lentiviral constructs pLB (#11619) and pLKO (#8453) were purchased from Addgene. shRNA oligos for Spy1 and a scrambled control were ligated into the pLKO and pLB vectors ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the two fragments of FlipGFP B1-9 and B10-E5-B11-TEVcs-K5 were amplified from Addgene Plasmid #124429 via PCR ...
-
bioRxiv - Cell Biology 2019Quote: ... The donor plasmid to insert mEGFP into the N-terminus of lamin B1 was purchased from Addgene (Cat# 87422). TrueCut Cas9 protein v2 and TrueGuide 1-piece modified synthetic gRNA (GGGGTCGCAGTCGCCATGGC ...
-
bioRxiv - Cell Biology 2021Quote: pTRIP-SFFV-EGFP-NLS and the coding sequences of mEmerald-Lamin A/C and mEmerald-Lamin B1 were from Addgene. pLVX-N-GFP was a kind gift from Prof ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cyclin and Geminin modules were amplified from cDNA of the murine CH12 cell line and Cas9 from described plasmids (Addgene plasmid #43861) [36] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid for tagging the N-terminus of the human lamin B1 gene (LMNB1) with RFP was purchased from Addgene (LMNB1-mTagRFP-T, #114403). The plasmid sequence was validated by Sanger sequencing.