Labshake search
Citations for Addgene :
1 - 50 of 692 citations for Cyclic AMP Direct Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... A template plasmid (p-sfGFP-FRT-amp-FRT, Addgene #176620) was constructed by inserting a gBlock encoding sfGFP followed by an SV40 polyA sequence and a FRT-flanked ampicillin cassette in place of EGFP in the pEGFP-C1 plasmid (Clontech) ...
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat sequences (PguCas13b: Addgene 103853 ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat (DR) sequences (PguCas13b: Addgene 103853 ...
-
bioRxiv - Molecular Biology 2019Quote: ... with overhangs for direct cloning in pX330 (Addgene plasmid #48137). All primers used were ordered from Sigma and all Sanger sequencing reactions were done at Stabvida.
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) as described above ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... allowing for ligation into BsmBI digested plasmid that encodes RfxCas13d direct repeat (Addgene #138150). PspCas13b crRNA spacers were designed as 34-nt single-stranded forward and reverse oligos containing CACC and CAAC overhangs ...
-
bioRxiv - Molecular Biology 2023Quote: ... allowing for ligation into Bbsl-digested plasmid that encodes PspCas13b direct repeat (Addgene #103854). Oligos were ordered as single stranded DNA (IDT ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat (DR) sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) into lentiCRISPRv2 ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat (DR) sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) into lentiCRISPRv2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Microbiology 2022Quote: ... and the SLC35A1 gene were designed using CRISPR direct (https://crispr.dbcls.jp/; S1 Table) and each sequence was cloned into plentiCRISPR plasmids [37] (Addgene plasmid #52961 ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Genomics 2024Quote: ... and the top 3 sgRNAs were individually cloned into single sgRNA expression vectors with direct capture cs1 sequences (Addgene # 122238)10 using restriction digest (BstXI and BlpI ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Neuroscience 2023Quote: ... we expressed GCaMP6s by direct microinjection of AAV2/1-hSyn-GCaMP6s-WPRE-SV40 (Addgene, 100843-AAV1, Titer: 2.5×1013 GC/mL) into the visual cortex ...
-
bioRxiv - Bioengineering 2023Quote: ... crRNA expression plasmids for the Type I Eco Cascade system were generated by annealing synthetic DNA ultramers (IDT) containing direct repeats (DRs) and cloning these ultramers into the BbsI and SacI-digested SpCas9 sgRNA cloning plasmid (Addgene #47108) using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Genomics 2024Quote: ... and the top two scoring sgRNAs for each target gene based on depletion or enrichment phenotypes were cloned into dual sgRNA lentivirus expression vectors with direct capture tags (Addgene 187241)40 using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs #E2621L ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Synthetic Biology 2024Quote: ... sgRNAs containing 20-nucleotide (nt) spacer sequences to direct Cas9 cleavage were encoded on donor or guide plasmids constructed from pAM041 (Figure S2, Addgene ID 217969) as described below ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Immunology 2019Quote: ... pCMV-DR8.2 (5 ng, Addgene #12263) and 2.5 μg of the lentiviral vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Neuroscience 2021Quote: ... or KH1*KH2* mutants were PCR amplified from their respective pAc5.1B-EGFP vector and cloned into the HindIII and EcoRI sites of the pAc5.1-lambdaN-HA vector (a gift from Elisa Izaurralde; Addgene plasmid #21302) (Behm-Ansmant et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... was PCR amplified and cloned downstream of EGFP in the pAc5.1B-EGFP vector (a gift from Elisa Izaurralde; Addgene plasmid #21181) using the HindIII and EcoRI restriction sites to make pAcB5.1-EGFP-FMRP ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...