Labshake search
Citations for Addgene :
1 - 50 of 1518 citations for Cow Upstream stimulatory factor 1 USF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... a stimulatory G-protein coupled receptor (custom made Chemogenetics AAV: Addgene). Clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2022Quote: ... placed upstream of GFP for histology and gene expression experiments, and upstream of GCaMP7f (Dana et al., 2019) (modified from Addgene plasmid #104495), or a conditional version of GCaMP8s (Zhang et al. ...
-
bioRxiv - Cancer Biology 2021Quote: A promoter and enhancer element upstream of mouse Fabp4 (from Addgene #8858) was cloned into pAAV-iCre-WPRE (Vector Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... reporter under the constitutive elongation factor 1-α (EF1α) promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486 ...
-
bioRxiv - Physiology 2022Quote: ... reporter under the constitutive elongation factor 1-α (EF1α) promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid # 72486 ...
-
bioRxiv - Genomics 2021Quote: ... 100 ng of a synthetic gblock encoding the the HS-CRM8-TTRmin module38 upstream of dsRed (Integrated DNA Technologies) and 1 μg of sgOpti (gift from Eric Lander and David Sabatini, Addgene plasmid #85681)39 ...
-
bioRxiv - Systems Biology 2023Quote: ... upstream of a T2A-mCherry-BSD marker using GoldenGate cloning into backbones pJT126 (Addgene #161926). For validations ...
-
bioRxiv - Plant Biology 2019Quote: ... thaliana egg cell specific promoters [25] was then inserted upstream of the Cas9-mApple coding sequence to create GS2.1/EC (www.addgene.org, plasmid #132568 (RRID:Addgene_132568)).
-
bioRxiv - Molecular Biology 2022Quote: ... U6-pegRNA cassette expressing the ATP1A1-Q118R and T804N cassettes were cloned upstream of the U6-RFP-acceptor cassette to create ATP1A1_G4_Q118R_Dual_pegRNA (Addgene 173199) and ATP1A1_G6_T804N _Dual_pegRNA (Addgene 173200) ...
-
bioRxiv - Molecular Biology 2019Quote: ... upstream and downstream sgRNAs were cloned under an U6 promoter into the pSpCas9(BB)-2A-GFP (Addgene #48138) and the pSpCas9(BB)-2A-mCherry (generated in house ...
-
bioRxiv - Molecular Biology 2022Quote: ... The U6-ATP1A1 gRNA (G2) cassette was also cloned upstream of the U6-BbsI-sgRNA cassette to create ATP1A1_G2_Dual_sgRNA (Addgene 173201) for ABE coselections ...
-
bioRxiv - Molecular Biology 2022Quote: ... The U6-ATP1A1 nick gRNA cassettes were cloned upstream of the U6-BbsI-sgRNA cassette to create ATP1A1_G3_Dual_sgRNA (Addgene 173202) and ATP1A1_G8 _Dual_sgRNA (Addgene 178104) ...
-
bioRxiv - Genetics 2022Quote: ... Either the upstream or the downstream guide was cloned into plasmid LRG (Lenti_sgRNA_EFS_GFP; deposited by Christopher Vakoc (Addgene # 65656) which expresses GFP ...
-
bioRxiv - Genetics 2023Quote: The N- and C-terminally TurboID-tagged constructs were generated by cloning the coding region of kdm5 upstream or downstream of HA:TurboID from pCDNA3-TurboID (RRID:Addgene_107171)(46 ...
-
bioRxiv - Cell Biology 2024Quote: ... templates were constructed by cloning the 0.9-1.2 kb upstream and downstream homology arms into pPD95.77 vector (Addgene #37465) using In-Fusion® HD Cloning Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: The reporter construct (traffic jam enhancer driven GFP_P2A-Blasticidin-resistance harboring 10 intronic boxB sites and 14 upstream UAS sites; plasmid submitted to Addgene) was integrated into chromosomal location chr2L:9,094,918 ...
-
bioRxiv - Developmental Biology 2021Quote: ... JHREs were inserted upstream of the minimal hsp70b promoter and eGFP coding sequence of pS3aG transformation vector (Addgene #31171) containing an attb for site-specific integration ...
-
bioRxiv - Microbiology 2020Quote: ... a 6.6 kb genomic fragment of nhr-49 gene (comprising of 4.4 kb coding region covering all nhr-49 transcripts plus 2.2 kb sequence upstream of ATG) was cloned into the GFP expression vector pPD95.77 (Addgene #1495), as reported previously (Ratnappan et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The LexA_ER_B112 transcription factor was amplified from Addgene_58437 (FRP880_PACT1(−1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling ...
-
bioRxiv - Molecular Biology 2020Quote: ... FET4 was cloned with ∼400bp of the upstream promoter into the pAG425 (resulting plasmid named pBMW182a) backbone using the Yeast Gateway System Vectors (obtained from Addgene) (Alberti et al. ...
-
bioRxiv - Biophysics 2021Quote: ... sgRNAs targeting the intron upstream of the respective splice branch point were cloned into pX458 (Addgene 48138, Dr. Feng Zhang), and sgRNAs targeting the intron downstream of the target exon were cloned into pX458-Ruby (Addgene 110164 ...
-
bioRxiv - Cell Biology 2021Quote: ... CHO cell lines were transfected with a reporter construct containing three copies of the PPRE placed upstream of the thymidine kinase promoter-firefly luciferase fusion gene (PPRE X3-TK-luc, Addgene). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting genomic region immediately upstream of the translation stop codon of Sox2 or Sox15 was cloned into LentiCRISPRv2 vector (Addgene). Single-stranded (ss ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragments were inserted using KpnI and MluI sites into the pCAG vector backbone containing a zinc-finger binding site upstream of a CAG promoter prepared from pCAG-GPHN.FingR-EGFP-CCR5TC (Addgene #46296)17.
-
bioRxiv - Molecular Biology 2019Quote: ... was chosen to target the TIP5 locus on exon 3 three base pairs upstream of the ATG start codon and was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene). This plasmid was co-transfected with the HDR repair template plasmid containing the FLAG/HA inclusion flanked by 1kb homology arms into wild type ESCs at a molar ratio of 1:3 ...
-
bioRxiv - Genetics 2020Quote: ... the reporter construct was made by cloning the sequence for Renilla luciferase and SARS-CoV-2 frameshift signal in the 0 frame upstream of the firefly luciferase sequence in the pISO plasmid (Addgene), with firefly luciferase in the −1 frame ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 20 bp proximal and distal PAM regions were introduced upstream of gRNA scaffold into two separate pU6-BbsI-chiRNA vectors (Addgene) via blunt-end ligation-mediated insertional mutagenesis using primer pairs PK241_F/PK243_R and PK242_F/PK243_R respectively (Table S7).
-
bioRxiv - Molecular Biology 2023Quote: ... containing its endogenous intron were fused upstream of 2A self-cleaving peptide and eGFP and cloned into an MSCV vector (PIG, Addgene) [100] ...
-
bioRxiv - Microbiology 2023Quote: ... we cloned ∼750 bp of the regions upstream and downstream of the sRNA into the multiple cloning site of pSIE1 (a gift from Andrew Goodman, Addgene plasmid #136355 ...
-
bioRxiv - Microbiology 2023Quote: ... the V5-tag sequence followed by a Stop codon was introduced upstream of the IRES in the pLVX-IRES-Neo vector (Clontech, Addgene), using annealed oligo-cloning ...
-
bioRxiv - Molecular Biology 2023Quote: gRNA targeting a site 208 bp upstream from the CAG tract was inserted into the 3xFLAG- dCas9-HA-2xNLS (Addgene) plasmid by digesting the plasmid with BsmBI (Esp3I ...
-
bioRxiv - Synthetic Biology 2023Quote: ... construct was made by also acquiring a lentiviral transfer plasmid containing the GAL4-VP64 inducible upstream activator sequence (UAS) from Addgene (pHR_5x Gal4 UAS was a gift from Wendell Lim (Addgene plasmid # 79119 ...
-
bioRxiv - Molecular Biology 2020Quote: ... At least two independent sets of oligonucleotide pairs for gene knockdown of human MTs and the transcription factor MTF-1 (supplementary table S4) were synthesized and cloned into the pLKO.1-TCR vector (Addgene, Cambridge, MA, USA); the same vector was also used as an empty vector control ...
-
bioRxiv - Developmental Biology 2022Quote: ... The H2B-miRFP670 fragment was digested with the Cpol (Rsrll) and Klfl enzymes and inserted upstream of the Hygromycin resistance gene cassette of the ES-FUCCI plasmid (Addgene #62451). RAF-ERT2 (Hamilton and Brickman 2014 ...
-
bioRxiv - Neuroscience 2020Quote: ... was generated by cloning the 299 bp genomic sequences immediately upstream of the Ir75b start codon (as in the previously-described Ir75b-GFP transgene25) into pDESTHemmarR (Addgene 31222) and integrated independently into attP5 and attP2 (on chromosome II and III ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Three elements of the reporter were amplified from the following sources: five TetO binding sites upstream of a pEF promoter from PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins (Addgene #78099), TagRFP-T from pEN_ERK.KTR-tagRFP-T ...
-
bioRxiv - Cell Biology 2020Quote: ... with oligos 5’-CCCaagcttACCATGGACTATAAGGACGATGATGACAAAGAACACCAGCTCC-3’ and 5’-CCCaagcttCTCCGGATTACCTTCATCCTTATGTAGATAAGAGTGCTGCAG-3’ and cloned into the HindIII site in frame upstream of pcDNA5 FRT/TO 3xHA-Venus-1xminAID (Daniel et al., 2018) (identical to Addgene #117714) but with a neomycin instead of hygromycin resistance ...
-
bioRxiv - Genetics 2021Quote: ... Pairs of guide RNAs targeting upstream (5’) and downstream (3’) flanking sequences were designed and cloned into LentiCRISPRv2-GFP (Addgene #82416) and LentiCRISPRv2-mCherry (#99154 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Developmental Biology 2024Quote: ... USA) or GENEWIZ from Azenta Life Sciences (South Plainfield, NJ, USA) and subsequently cloned upstream of a H2B-mCerulean (Addgene #198059). Promoter activity was scored by microinjecting 25ng/μl of circular plasmid and screening for fluorescence in embryos 24 hours post fertilization (hpf) ...
-
bioRxiv - Cell Biology 2022Quote: Guide RNA designed to cut close to the 70-nucleotide region upstream of the ADC17 start codon (agtaacataatgtgctcagcagg) was inserted into pML104 (Addgene number: 67638) to generate pML104-ADC17-70nt ...
-
bioRxiv - Developmental Biology 2022Quote: ... LR gateway cloning was then used to subclone the fragments into the pBPGUw plasmid upstream of GAL4 (a gift from Gerald Rubin, Addgene plasmid #17575). The resulting constructs were inserted into landing site 86Fb using phiC31 mediated germline transformation by either BestGene Inc or the Cambridge injection facility ...
-
bioRxiv - Cell Biology 2022Quote: ... CMV-EGFP-FRB-EEA1 was generated by site-directed mutagenesis to remove the stop codon upstream of FRB from pEGFP-FRB (Addgene, Cat #25919). Next ...
-
bioRxiv - Developmental Biology 2022Quote: ... as well as a lens-specific crystallin promoter upstream of mCherry (iTol2Amp-γ-crystallin:RFP, a gift from Nadia Mercader Huber; Addgene plasmid # 108455)71 ...
-
bioRxiv - Genetics 2023Quote: A plasmid construct for the expression of Q35::mCherry was generated by inserting the sequence encoding Q35 upstream of mCherry in pGH8 (gift from Erik Jorgensen; Addgene plasmid #19359) and replacing the promoter with a 880-base pair sequence corresponding to the vha-6 promoter using the NEBuilder HiFi DNA Assembly cloning kit ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were cloned into pCFD4 (Addgene plasmid 49411)57 and the 1kb regions upstream and downstream of the cut sites were cloned into vector pHD-attP-DsRed (Addgene plasmid 51019)58 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Genetics 2020Quote: ... targeting upstream and downstream of LTRs of interest were annealed and cloned into modified eSpCas9 (1.1) vector (Addgene 71814, deposited by Feng Zhang), which expresses GFP ...