Labshake search
Citations for Addgene :
1 - 50 of 977 citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Biophysics 2019Quote: ... CTD of the largest subunit of human RNA polymerase II (RPB1, Addgene 35175) and EGFP (Addgene 122147 ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Cancer Biology 2019Quote: ... mutant PI3K p110α subunit (pMIG-PI3KE545K, Addgene); Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
bioRxiv - Genetics 2024Quote: ... or the Alpha (Addgene # 170451), Beta (Addgene # 170449) ...
-
bioRxiv - Biochemistry 2023Quote: The Homo sapiens EHMT1 catalytic subunit (Addgene plasmid #51314) and H ...
-
bioRxiv - Developmental Biology 2023Quote: ... or EGFP-alpha-Tubulin (Addgene #56450) and grown 24 hr ...
-
bioRxiv - Physiology 2023Quote: FLAG-IKK2 kinase inactive K44M (IKK2DN, Addgene, #15466) was cloned into pLenti-CMV-Puro DEST vector (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... miniSOG-Alpha-V-Integrin-25 (Addgene plasmid # 57763)51 and Beta1-GFP in pHcgreen donated by Martin Humphries (Addgene plasmid # 69804)52 ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366 ...
-
bioRxiv - Biochemistry 2019Quote: ... sapiens Pyk2 kinase domain expression vector PTK2BA encoding H6-TEV-kinase [414-692] was a gift from Nicola Burgess-Brown (Addgene # 42401). Cloning vector pET-H6-SUMO-TEV-LIC (1S ...
-
bioRxiv - Cell Biology 2021Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene 53755-53762) (73) ...
-
bioRxiv - Cell Biology 2019Quote: ... Histidine-tagged PKA catalytic subunit (a gift from Susan Taylor, Addgene plasmid #14921) and PKI3 were previously described ...
-
bioRxiv - Molecular Biology 2022Quote: ... or pRK5-MYC-mTOR kinase-dead (Addgene plasmid #8482)) using the TransIT-X2 transfection reagent (Mirus ...
-
bioRxiv - Cancer Biology 2023Quote: A human kinase domain-focused gRNA library (Addgene 117725) [25] was used to assess CRISPR Cas9 screening as a tool in breast cancer PDTO to identify whether novel vulnerabilities could be detected for each PDTO ...
-
bioRxiv - Biophysics 2023Quote: The EGFP-alpha-synuclein gene was amplified from Addgene plasmid # 40822 (EGFP-alpha-synuclein-WT was a gift from David Rubinsztein (http://n2t.net/addgene:40822 ...
-
bioRxiv - Neuroscience 2020Quote: ... GABA (A) receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168 ...
-
bioRxiv - Cancer Biology 2023Quote: Each individual Mediator subunit was cloned and expressed in a pLIB plasmid (Addgene #80610). MED12 ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... and constitutively kinase-active (#64608) IKKα were purchased from Addgene. Briefly ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Molecular Biology 2019Quote: ... we modified the vector pET21a-alpha-synuclein (Addgene plasmid 51486) by introducing a 6x-histidine tag followed by a TEV cleavage site to the N-terminal of α-Syn ...
-
bioRxiv - Cell Biology 2022Quote: ... mCh-alpha-tubulin63 was a gift from Gia Voeltz (Addgene plasmid # 49149 ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2022Quote: ... YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene, catalog #: 15245), and cerulean (a CFP variant ...
-
bioRxiv - Immunology 2022Quote: ... for Alpha-S and pcDNA3.3-SARS2-B.1.617.2 (Addgene, no.172320) for Delta-S proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-ROCK2 was a gift from Alpha Yap (Addgene plasmid # 101296)(88) ...
-
bioRxiv - Cell Biology 2020Quote: GFP-mROCK2 was a gift from Alpha Yap (Addgene plasmid # 101296). 500 ng of plasmid DNA was transfected into 1×105 hTERT RPE-1 cells in DMEM/F12 medium containing 10% fetal calf serum (FCS) ...
-
bioRxiv - Cell Biology 2021Quote: The pIRESneo-EGFP-alpha Tubulin plasmid was obtained from Addgene (USA) and mutation (Y224G ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-Alpha-Actinin-19 (Addgene #54975, gift from Michael Davidson), pCMV-mApple-MyosinIIA-N-18 (Addgene #54930 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989, gift from Michael Davidson), pCMV-mCherry-Alpha-Actinin-19 (Addgene #54975 ...
-
bioRxiv - Cell Biology 2022Quote: ... The ORF of EPLIN isoform alpha was PCR amplified from Addgene plasmid #40928 to generate plasmid #1 ...
-
bioRxiv - Plant Biology 2019Quote: ... Plasmid pN_35S/CTP-mCitrine was produced in an earlier study [41] and encodes an mCitrine fluorescent protein fused in-frame to the chloroplast transit peptide from RuBisCO small subunit 1A (www.addgene.org, plasmid #117989 (RRID:Addgene_117989)) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 65]: CFP was inserted into the TM3-TM4 intracellular loop of the β2 subunit (Addgene, catalog #: 15106), YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Physiology 2019Quote: ... pSG5 PPAR alpha was a gift from Bruce Spiegelman (Addgene plasmid # 22751). FHRE-Luc was a gift from Michael Greenberg (Addgene plasmid # 1789) ...
-
bioRxiv - Microbiology 2022Quote: ... mCh-alpha-tubulin was a gift from Gia Voeltz (Addgene cat. 49149), while pcDNA-D1ER was a gift from Amy Palmer & Roger Tsien (Addgene cat ...
-
bioRxiv - Biochemistry 2022Quote: ... mCherry was PCR amplified from mCherry-Alpha-5-Integrin-12 (Addgene #54970) using forward primer 54970RMmCherryaddNHis_F2 ...
-
bioRxiv - Cell Biology 2021Quote: mApple-Alpha-5-Integrin-12 was a gift from Michael Davidson (Addgene plasmid # 54864 ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP-AHPH-DM (a gift from Alpha Yap, Addgene plasmid # 71368) were subcloned using following primers to create Gateway attB PCR products ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-Snf1 kinase domain (Snf1-KD) expression vector was purchased from Addgene (#52683). Those DNA constructs were transformed in Rosetta2 (Novagen ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... employing the construct pIRESneo-EGFP-alpha Tubulin (a gift from Patricia Wadsworth; Addgene plasmid #12298 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the mApple-Alpha-V-Integrin-25 was a gift from Michael Davidson (Addgene plasmid # 54866 ...