Labshake search
Citations for Addgene :
1 - 50 of 1170 citations for Chemokine C X C Motif Ligand 3 CXCL3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... into an empty pCCL-c-MNDU3-X backbone (#81071 Addgene). To generate the WILD-seq library ...
-
bioRxiv - Neuroscience 2021Quote: ... Figs. 4A-C, 5, and 7B,C, and Supplementary Movies 1,2; Salk Vector Core; 2.5 x 1012; Addgene plasmid #50973); AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Biochemistry 2021Quote: ... or control peptides with the binding motifs mutated were fused to C terminus of EGFP and cloned to pLJM1-EGFP vector (David Sabatini lab, Addgene plasmid #19319).
-
bioRxiv - Bioengineering 2021Quote: ... the sequence encoding the PE2 C terminus (PE2-C term) (Addgene #132775), and the WPRE sequence (Addgene #52962 ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...
-
bioRxiv - Biochemistry 2020Quote: ... pDEST26-C-FLAG (Addgene #79275) [22] vector ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Met (Addgene; 31784) plasmids were purchased from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pOPARA2 or pPGC-C (Addgene plasmid # 174580 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042; http://n2t.net/addgene:85042; RRID:Addgene_85042) and GFP-TM(SAC1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and WPRE were cloned into the EcoRI site of pCCL-c-MNDU3-X (gift from Donald Kohn, Addgene plasmid #81071) or pMYs (Cell Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... NM_018344.6 (SLC29A3):c.1427A>G (p.Ter476Trp) and NM_000343.4(SLC5A1):c.1993T>C (p.Ter665Arg)) were cloned into pCDNA3.1-HA (Addgene 128034) using Gibson assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... pMXs-c-Myc (Addgene Plasmid #13375) per 10 cm dish using Fugene 6 (Catalog# Promega# E2691) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pT3-EF1a-c-Met (31784, Addgene) or pCMV-Hygro-LINC01510 (Twist Bioscience ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-C-18 (Addgene #53978), and mApple-paxillin-22 (Addgene #54935) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCardinal-H2B-C-10 (Addgene #56162)11 ...
-
bioRxiv - Cancer Biology 2022Quote: mCherry-Lamin A/C (Addgene #55068) and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Biochemistry 2021Quote: ... C-terminal MBP plus His6 (Addgene_37237); N-terminal His6 plus glutathione S-transferase (GST ...
-
bioRxiv - Cancer Biology 2021Quote: ... or C-Flag-Rela (Addgene #20012) using 25μL Lipofectamine and 4.5μg plasmid DNA in 600μL Optimem total ...
-
bioRxiv - Plant Biology 2020Quote: ... or pAG426GAL_ccdB_eGFP (Addgene; C-terminal GFP fusion).
-
bioRxiv - Plant Biology 2019Quote: ... a C-terminal 3xFLAG epitope (AddGene #50308) and a Nos-terminator (AddGene #50266 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry-Histone H2B-C-10 (Addgene #55057), and mCherry-LAMINB1-10 (Plasmid #55069 ...
-
bioRxiv - Immunology 2021Quote: ... pMIEG3-c-Jun and pMIEG3-JunB (Addgene #116747 ...
-
bioRxiv - Immunology 2020Quote: ... mCherry-Dectin1A-C-10 (Addgene plasmid # 55025), and mCherry-Dectin1A-N-10 (Addgene plasmid # 55026 ...
-
bioRxiv - Immunology 2020Quote: ... Emerald-Dectin1A-C-10 (Addgene plasmid # 54057), mCherry-Dectin1A-C-10 (Addgene plasmid # 55025) ...
-
bioRxiv - Neuroscience 2022Quote: ... and pMXs-c-MYC (Addgene, Cambridge, MA) as reported previously77 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Genetics 2019Quote: ... Only a single site upstream of the c(3)GccΔ1 deletion was selected (AAAGCTTTGTTGGCCTGTATTGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense (CTTCGAAAGCTTTGTTGGCCTCTAT ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4–1026 bp for the N-terminus and 2578–4563 bp for the C-terminus) was subcloned into C-Flag-pcDNA3 (Addgene, plasmid # 20011 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... a C-terminal FLAG tag (pICSL50007, Addgene #50308), and a 3’ untranslated region and terminator sequence (3UTR ...
-
bioRxiv - Neuroscience 2020Quote: ... KLF4 and c-MYC were obtained from Addgene 62 ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF5C(1-560)-2xmCh-EF(C) (Addgene #61664) and KIF5C(1-560)-mCit (Addgene #61676 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The C-FLAG-pcDNA3 expression vector (Addgene 20011) was also used as a negative control for FLAG-tagged ZDHHC expression ...
-
bioRxiv - Cancer Biology 2023Quote: ... to the MAC-Tag-C vector (Addgene #108077) [44] ...
-
bioRxiv - Bioengineering 2023Quote: ... and pSECRETS-C (p11.LacY.wtx1 plasmid (Addgene #69056) high copy pBR322 ori ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... and Cbh_v5 AAV-ABE C-terminal (Addgene: 137178) and replaced the coding sequence of SpCas9 with the N-or C-terminal parts of Cas9-NRTH ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal GR tag (pEPOZ0CM0137; Addgene #197535) and the CaMV35s terminator (pICH41414) ...
-
bioRxiv - Biophysics 2023Quote: ... and mRuby2-Lamin A/C (Addgene plasmid # 55901) were produced in HEK293T cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... pBabe-c-myc-zeo (17758, Addgene, Cambridge, MA) or pBabe-KLF6-SV1 virus ...
-
bioRxiv - Microbiology 2021Quote: ... RNA motif plasmid EDEN15 (Addgene plasmid # 107252 ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-Lamin A-C-18 (Addgene plasmid no. 54138) and mEmerald-Nucleus-7 (Addgene plasmid no ...
-
bioRxiv - Biophysics 2019Quote: ... mEmerald-PMP-C-10 (PMP-mEmerald, Addgene plasmid #54235), mCherry-Peroxisomes-2 (peroxisome lumen marker ...