Labshake search
Citations for Addgene :
1 - 50 of 163 citations for Caspase Recruitment Domain Family Member 17 CARD17 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: The pJT126 lentiviral recruitment vector (Addgene #161926) was pre-digested with 10,000 U/mL Esp3I (NEB #R0734L ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were cloned into a lentiviral recruitment vector pJT126 (Addgene #161926) with 4-16x 10 ul Golden-Gate reactions (75 ng of pre-digested and gel-extracted backbone plasmid ...
-
bioRxiv - Systems Biology 2023Quote: The libraries were cloned into a lentiviral dCas9 recruitment vector pJT216 (Addgene #187320) with 4-10x 10 μl GoldenGate reactions (75 ng of pre-digested and gel-extracted backbone plasmid ...
-
bioRxiv - Biophysics 2021Quote: ... Activation domains were obtained from Addgene plasmid #63798 (VPR ...
-
bioRxiv - Cell Biology 2022Quote: INCENP kinetochore recruitment by rapamycin addition was achieved by editing a previously described system (plasmid pERB109, Addgene number58280) (31) ...
-
bioRxiv - Biophysics 2021Quote: ... CRY2PHR and CIBN domains were taken from Addgene plasmid #26866 and #26867 ...
-
bioRxiv - Systems Biology 2023Quote: The BTK-PH domain was obtained from Addgene construct #51463 (a gift from Dr Tamas Balla) ...
-
bioRxiv - Molecular Biology 2022Quote: pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
bioRxiv - Systems Biology 2022Quote: ... and added undiluted to K562 cells for a final cell concentration of 3-4 x 105 cells/mL for pJT126-based effector recruitment vectors (Addgene #161926) or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene ...
-
bioRxiv - Cell Biology 2021Quote: The plasmid containing the TRF2-ΔB-ΔM (deletion mutant lacking the N-terminal basic domain and C-terminal Myb domain) was obtained from Addgene (plasmid #2431), as previously described (Barinda et al. ...
-
bioRxiv - Cancer Biology 2023Quote: A human kinase domain-focused gRNA library (Addgene 117725) [25] was used to assess CRISPR Cas9 screening as a tool in breast cancer PDTO to identify whether novel vulnerabilities could be detected for each PDTO ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for GFP-tagged two FYVE domains of mouse HRS and PH domain of human TAPP1 were obtained from Addgene (#140047 and #161985, respectively) and cloned into the pLVX-IRES-puro vector ...
-
bioRxiv - Biophysics 2021Quote: ... The p300 core histone acetyltransferase domain was derived from Addgene plasmid #61357 ...
-
bioRxiv - Immunology 2022Quote: ... CAR-specific domains were removed from pSLCAR-CD19 (Addgene #135992), leaving a linearized plasmid containing a short EF1a promoter and a P2A-NeonGreen reporter sequence ...
-
bioRxiv - Genomics 2022Quote: ... the KRAB(KOX1) domain from dCas9-BFP-KRAB (Addgene # 46911) was fused to the C-terminus of dCas9 ...
-
bioRxiv - Cancer Biology 2023Quote: pBMN-FKBP-YFP destabilization domain plasmid was purchased from Addgene RRID:Addgene_31763 ...
-
bioRxiv - Immunology 2020Quote: ... SH2 domain sequences were obtained from Addgene (pGEX-SHP-1(NC)-SH2 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... while the Traptavidin domain came from pET21a-Core-Traptavidin (Addgene, #26054). Each catcher was individually Gibson assembled into the αGCN4-p65HSF1-CO backbone by replacing the αGCN4 ...
-
bioRxiv - Cell Biology 2023Quote: ... the CRY2 PHR domain was PCR amplified from pCRY2PHR-mCherryN1 (Addgene plasmid #26866 ...
-
bioRxiv - Neuroscience 2023Quote: ... and cpGFP and RSET domain were subcloned from GCaMP6f (Addgene plasmid # 52924). To enhance cytoplasmic localization of cAMPinG1 ...
-
bioRxiv - Neuroscience 2023Quote: ... To introduce the domain-specific protospacer sequences into the pCFD4 vector (Addgene), we employed the ligation-independent Gibson Assembly method (NEBuilder ...
-
bioRxiv - Microbiology 2024Quote: The KRAB domain from pHR-SFFV-dCas9-BFP-KRAB (Addgene plasmid #46911) was cloned into plasmid pHR-SFFV-ZF3-P2A-BFP using Gibson assembly (New England Biolabs Cat#E2611S ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-Snf1 kinase domain (Snf1-KD) expression vector was purchased from Addgene (#52683). Those DNA constructs were transformed in Rosetta2 (Novagen ...
-
bioRxiv - Neuroscience 2019Quote: ... pyogenes dCas9 fused to two copies of the VP64 transactivator domain (Addgene #59791). Endotoxin-free plasmids were purified using an endotoxin-free plasmid DNA purification kit (Machery-Nagel ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 17 μg of plentiCas9-Blast (Addgene, Watertown, MA; #52962) by the calcium phosphate method ...
-
bioRxiv - Developmental Biology 2022Quote: The LARRY lentiviral barcoding library 17 was purchased from Addgene (https://www.addgene.org/pooled-library/camargo-plarry-egfp-barcoding-v1/) ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The LOV2 domain was PCR amplified from the vector CMV-CASANOVA (Addgene plasmid #113035) previously reported by us (29) ...
-
bioRxiv - Cancer Biology 2019Quote: ... the KRAB domain was PCR amplified using pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911) as a template ...
-
bioRxiv - Genomics 2021Quote: ... Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). PUF9R-tethered iRFP670 and mRuby2 were created by a combination of PCR (from IDT gBlocks ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids encoding HA-tagged LRR (leucine-rich-repeat) domains of LRRFIP2 (Addgene plasmid # 21152), and Fli1 (Addgene plasmid # 21151) ...
-
bioRxiv - Genetics 2022Quote: ... The ecDHFR degron domain was amplified from CAG-DDdCas9VP192-T2A-EGFP-ires-puro (Addgene plasmid # 69534 ...
-
bioRxiv - Genomics 2024Quote: Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). Cloning of dCas9 expression plasmid (lenti-dCas9-Blast ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ElonginC (17–112) and ElonginB (1–104) (Addgene ID 204500 & 204501) were co-expressed in E ...
-
bioRxiv - Developmental Biology 2020Quote: The histone acetyltransferase domain from human p300 was subcloned from a published construct (Addgene, 61357) (Hilton et al. ...
-
bioRxiv - Cancer Biology 2019Quote: The mSMO and ShhN (Shh N-terminal domain) plasmids purchased from Addgene (#37673 and #37680). All vectors were propagated in XL10 Gold competent cells ...
-
bioRxiv - Neuroscience 2021Quote: ... mCherry-SH2-mCherry was prepared from the C-terminal SH2 domain of p85a (Addgene #46463). The linker between mCherry and SH2 is SGLRSRAQASNSAVDGTA for the N terminus and GSG for the C terminus.
-
bioRxiv - Cell Biology 2022Quote: ... were transformed with a plasmid encoding the GST-tagged domain of Rhotekin (Addgene plasmid # 15247). Cells were cultivated in Terrific broth (TB ...
-
bioRxiv - Bioengineering 2020Quote: ... KRAB domain was derived from pHAGE EF1α dCas9-KRAB (Addgene 50919, Kearns et al., 2014). VPR complex was derived from lenti-EF1a-dCas9-VPR-Puro (Addgene 99373 ...
-
bioRxiv - Neuroscience 2019Quote: ... was constructed by amplifying the KASH domain from (Addgene 60231, a gift of Feng Zhang) and fusing it (in-frame ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2023Quote: ... All PNP domains tested for toxicity were cloned into the pBbA6c vector65 (Addgene plasmid # 35290) under the IPTG-inducible pLac promoter.
-
bioRxiv - Genetics 2023Quote: ... and the NLS-Gal4AD domain from a plasmid originally based on pActL-Gal4AD (Addgene 15303) and the 127D01 tag was inserted as part of the primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... and CD28TM CAR domains were amplified from the plasmids pSLCAR-CD19-hCAR-BB (Addgene, #135992) and pSLCAR-CD19-28z (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Immunology 2021Quote: ... C domain coding sequences of human CRT were cloned into the pCMV vector (Addgene plasmid #59314) to generate recombinant constructs with C-terminal Human IgG1Fc (Ig ...
-
bioRxiv - Biochemistry 2021Quote: A pET28a plasmid containing the SENP2 catalytic domain (cat.SENP2) was obtained from Addgene (Catalog number 16357).44 The protein was expressed and purified from E ...
-
bioRxiv - Bioengineering 2021Quote: ... as well as the CD8α hinge and transmembrane domains were cloned into pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene # 12252) or SFG.CNb30_opt.IRES.eGFP (Addgene # 22493 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Spy and Snoop catcher domains were cloned from the pET28a-SpyCatcher-SnoopCatcher plasmid (Addgene, #72324) while the Traptavidin domain came from pET21a-Core-Traptavidin (Addgene ...