Labshake search
Citations for Addgene :
1 - 50 of 188 citations for Caspase 9 CASP9 Antibody Pair since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10ug pX458 2.0 plasmid pairs (Addgene) encoding Cas9 and sgRNAs were transfected using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/9 (Addgene #112865), or rAAV2-retro (Addgene #81070 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV2/1.ef1a.fDIO.GCaMP6s (Janelia Vector Core) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/9 (Addgene #112865), or pUCmini-iCAP-PHP.eB (Addgene #103005) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (Addgene #112865), pAAV-hSyn-Cre (Addgene #170367)61 ...
-
bioRxiv - Molecular Biology 2022Quote: pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
bioRxiv - Cell Biology 2024Quote: ... and a pair of TALENs (Addgene # 59025, # 59026) through co-electroporation into hPSCs ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV2/9 Helper (Addgene, #112867), and pAd-deltaF6 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... psPAX2 (Addgene 12260, 9 µg), the guide containing vector (pXPR_066 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 9 µg psPAX2 (Addgene #12260), and 12 µg pLKO.1 transfer vector using Lipofectamine 2000 (Cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... 9 μg pMD2.G (Addgene #12259) and 3 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Physiology 2023Quote: ... and 9 μg of psPAX2 (Addgene), 6 μg of psPAX2 (Addgene) ...
-
bioRxiv - Neuroscience 2023Quote: ... with GFP1-9::iRFP702 (Addgene #130125), mouseStoml3-GFP10::mCHERRY and mouseElkin1-GFP11::eBP2 plasmids using Fugene HD and following manufacturer’s instructions (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... Four rats were injected into the right FC with 0.02 μL of AAV2/9-CaMKII-hChR2(E123A)-mCherry-WPRE.hGH (Catalog #AV-9-35506; Addgene plasmid #35506 ...
-
bioRxiv - Genetics 2022Quote: ... 9 µg psPax2 packaging plasmid (Addgene #12260), and 1 µg VSV-G envelope plasmid (Addgene #8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-GfaABC1D-GCaMP6f virus (Addgene #52925) was stereotaxically injected into the cortex 2 weeks before imaging ...
-
bioRxiv - Molecular Biology 2023Quote: ... Relevant gRNA pairs were cloned into lentiCRISPR v2-Blast (Addgene #83480) and lentiCRISPR v2 (Addgene #52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2/9-FLEX-tdTomato (Addgene, #28306-AAV9). For chronic window implantation ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 9 μg of psPAX2 packaging vectors (Addgene #12260) using polyethylenimine (Polysciences ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9). Assignment of AAV was counterbalanced for sex ...
-
bioRxiv - Neuroscience 2024Quote: ... serotype 9 (AAV9) expressing GCaMP6s (AAV9.CAG.GCaMP6s.WPRE.SV40, Addgene, USA) was injected subcutaneously in the nape of the neck of pups (P2-P6) ...
-
bioRxiv - Cell Biology 2020Quote: ... antisense oligonucleotide pairs were annealed and ligated into BbsI-linearized pJJR50 (Addgene #75026) (Waaijers et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... A pair of two precursor fragments with CI-NpuDnaBΔ290 ΔC39 (pHBDuet148, Addgene #121911) and CI-NpuDnaB (pHBBAD113 ...
-
bioRxiv - Developmental Biology 2021Quote: ... antisense oligonucleotide pairs were annealed and ligated into BbsI-linearized pJJR50 (Addgene #75026) (Waaijers et al. ...
-
bioRxiv - Immunology 2020Quote: ... Cas9/sgRNAs were cloned by annealing pairs of oligos into pX330 (Addgene, #42230) following the protocol previously described53 ...
-
bioRxiv - Neuroscience 2022Quote: ... oligonucleotide pairs were annealed and cloned into BbsI digested pX330 (Addgene, Plasmid#42230) (Cong et al. ...
-
bioRxiv - Biophysics 2023Quote: ... oligo pairs were annealed and ligated into BbsI -digested espCas9 plasmid (Addgene 71814). For validating the efficiency of gRNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... a pair of the GECs are cloned into a pBIG1D vector (Addgene, 80614) according to the biGBac assembly methods [27 ...
-
bioRxiv - Neuroscience 2023Quote: ... Each pair of sgRNAs was cloned into pAAV-U6-sgRNA-CMV-GFP (Addgene, #85451) by using the SapI restriction enzyme (BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Microbiology 2019Quote: ... The sgRNA cassette from pgRNA-bacteria 9 (Addgene plasmid # 44251) was introduced into pSCrhaB2 by restriction cloning with EcoRI and HindIII (NEB ...
-
bioRxiv - Neuroscience 2022Quote: We obtained the AAV serotype 9 hSyn-Cre from Addgene (#105555 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV.9.Ef1A.fDIO.EYFP (control for optogenetics, 140 nl, Addgene, no55641), ssAAV.1.2.hSyn1.dFRT.hM4D(Gi).mCherry(rev).dFRT.WPRE.hGHp(A ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... Oligonucleotide pairs were annealed and cloned into the transfer plasmid lentiCRISPRv2 (Addgene, https://www.addgene.org/52961/) and co- transfected with the three packaging plasmids pMDLg/pRRE ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotide pairs were manufactured by IDT and cloned into a lentiviral LT3GEPIR vector (Addgene: #111177) to allow for doxycycline-inducible repression of gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotide pairs were manufactured by Integrated DNA Technologies (IDT) and cloned into lentiCRISPRv2 (Addgene: #52961) as previously described (Sanjana et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... oligonucleotide pairs (Table S8) were used for PCR and inserted into pCFD5 (Addgene no. 73914) via Gibson Assembly ...
-
bioRxiv - Immunology 2021Quote: ... a pair of complementary DNA oligos was annealed and inserted into pX330 (Addgene plasmid # 42230) (Cong et al. ...
-
bioRxiv - Biophysics 2022Quote: ... and ANAP-specific amber suppressor tRNA/tRNA synthetase pair (Addgene #48696 (Chatterjee and Guo, 2013)) ...
-
bioRxiv - Genomics 2023Quote: ... guide pair 2: TTGCGGCGCTGTGGCGCCGA and CGCTCCCGCAAGTGGATGTC) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described [49] ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Neuroscience 2021Quote: The adenoassociated virus (AAV) pAAV2/9.CAG.FLEX.GCaMP6s.WPRE.SV40 was purchased from Addgene (Addgene viral prep #100842-AAV9 ...
-
bioRxiv - Molecular Biology 2019Quote: ... thermophilus LMD-9 generated in this study are available from Addgene. Protein and DNA sequences for all St1Cas9 ORFs are available as supplemental items (Excel file) ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-FilaminA-N-9 (Addgene #55047, gift from Michael Davidson), pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene, 83896) at a concentration of 6+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV.9.FLEX.rev.ChR2(H134R).mCherry (optogenetics, 140 nl, Addgene, no. 18916), AAV.9.Ef1A.fDIO.EYFP (control for optogenetics ...