Labshake search
Citations for Addgene :
1 - 50 of 1969 citations for Canine Adenovirus 1 and 2 Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... adenovirus helper plasmid pAdDeltaF6 (Addgene 112867) and pAAV-hSyn-EGFP (Addgene 50465) ...
-
bioRxiv - Genetics 2023Quote: ... an adenovirus helper plasmid (pAdΔF6; Addgene plasmid 112867), and an ITR-flanked AAV transgene expression plasmid AAV-CAG-eGFP (provided by Dr ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6 mice were injected with the AAV5-CAG-ChR2-mCherry adenovirus (200 nL, Addgene) in the PC ...
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus plasmid encoding EGFP-tubulin (pShuttle-EGFP-tubulin) was a gift from Torsten Wittmann (Addgene plasmid #24327 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SV40T antigen (Addgene Plasmid #21826) were obtained from Addgene.
-
bioRxiv - Biochemistry 2021Quote: ... SV40 T antigen lentiviral plasmid (Addgene #22298) was packaged in HEK 293T cells using helper plasmids pMD2.G (Addgene #12259 ...
-
bioRxiv - Microbiology 2020Quote: ... Her2 antigen was acquired from Addgene (pCDNA3). CD99 (GenBank ...
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus was constructed by subcloning the existing E-cadherin tension sensor into the pShuttle-CMV vector (Addgene, 16403), followed by recombination into the pAdEasy1 vector (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Large T SV40 antigen (Addgene plasmid # 21826) as described ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus plasmid encoding EGFP-tubulin (pShuttle-EGFP-tubulin) was a gift from Torsten Wittmann (Addgene plasmid #24327, RRID:Addgene_24327, [86]) and adenovirus was produced by the University of Michigan Vector Core.
-
bioRxiv - Neuroscience 2021Quote: ... Gad2-Cre mice received a stereotaxic injection (200 nL) of the AAV5-CAG-Flex-ChR2-tdTomato adenovirus (Catalog #18917, Addgene) into the MCPO ...
-
bioRxiv - Neuroscience 2023Quote: ... had the PiCo neurons successfully transfected by pAAV-hSyn Con/Fon hChR2(H134R)-EYFP adenovirus vector (cat# 55645-AAV8; AddGene, USA ...
-
bioRxiv - Neuroscience 2023Quote: ... had successful transfection of PiCo neurons by using a pAAV-hSyn Con/Fon hChR2(H134R)-EYFP adenovirus vector (cat# 55645-AAV8; AddGene, USA ...
-
bioRxiv - Cancer Biology 2022Quote: ... and SV40-T/t antigens expressing lentiviruses using vectors pLenti CMV-RasV12-Neo (w108-1) (HRAS G12V, #22259, Addgene), and pLenti-CMV/TO-SV40 small + Large T (w612-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... The SV40 Large T antigen and HA-TRIM71 were purchased from Addgene (plasmid # 136616 and #52717 ...
-
bioRxiv - Immunology 2024Quote: ... MEFs were transfected with SV40 small+large T antigen-expressing plasmid (22298, Addgene) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Cell Biology 2020Quote: ... SV40 Large T antigen CDS was subcloned from pBABE-puro-SV40 LgT plasmid (Addgene 13970) into LeGO iG vector between BamHI and EcoRI sites ...
-
bioRxiv - Neuroscience 2021Quote: ... MEFs were then expanded to 6-well plates and transiently transfected with SV40T antigen (Addgene) and maintained until stably proliferative ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Biochemistry 2020Quote: ... which were cloned into pX330A-1×2 (Addgene #58766) and combined with pX330A-2-PITCh (Addgene #63670 ...
-
bioRxiv - Neuroscience 2024Quote: ... A 1:2 viral mixture of pENN.AAV.CamKII 0.4.Cre.SV40 (Addgene, diluted 1:100,000) and pAAV-hSyn-DIO-EGFP (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transduced by thermosensitive retroviral gene transfer of SV40 T antigen (LOX-CW-CRE, Addgene) at a MOI of 5 in Proliferation UREC medium with 8μg/mL polybrene (64) ...
-
bioRxiv - Genomics 2021Quote: ... Early passage primary MEFs were transformed with SV-40 T antigen containing plasmid pBSSVD2005 (ADDGENE, Cambridge, MA) to generate immortalized MEFs ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Microbiology 2019Quote: ... They were immortalized by transduction with a retroviral vector encoding SV40 large T antigen (pBABE-zeo largeTcDNA, Addgene). The Atf6+/+ vs ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary MEFs were then immortalized by transient transfection with a plasmid expressing SV40 large T antigen (Addgene #21826). Single cell clones were then isolated by limiting dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were immortalized by transduction with a retrovirus expressing SV40 large T antigen from pBABE-puro largeTcDNA (Addgene plasmid # 14088 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Molecular Biology 2022Quote: ... early passage primary MEFs from all genotypes were infected in parallel with the SV40 large T antigen (Addgene:13970) (Zhao et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ...