Labshake search
Citations for Addgene :
1 - 50 of 70 citations for Anti SWAP 70 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: We then modified the original CRISPR-Swap plasmid (PFA0055, Addgene plasmid #131774) to replace its LEU2 selectable marker with the HIS3 selectable marker ...
-
bioRxiv - Genetics 2020Quote: ... The yeast were then transformed with 100 ng of CRISPR-Swap plasmid (pFA0055-gCASS5a, Addgene plasmid # 131774) and 1 μg of DNA repair template amplified either from BY ...
-
bioRxiv - Cell Biology 2020Quote: hZAP-70 was cloned into pLEX_307 vector (Addgene, #41392) using Gateway cloning strategy (https://www.thermofisher.com/us/en/home/life-science/cloning/gateway-cloning/gateway-technology.html) ...
-
bioRxiv - Systems Biology 2021Quote: ... 70 ng of VP12 humanSpCas9-Hf1 plasmid (Addgene 72247), and 175 ng of donor reporter plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... pGEXTK-Pak1 70-117 was a gift from Jonathan Chernoff (Addgene plasmid # 12217 ...
-
bioRxiv - Developmental Biology 2020Quote: ... pACU2_CD4-mIFP T2A HO1 from Xiaokun Shu 70 ordered from ADDGENE (72441) was modified ...
-
bioRxiv - Cell Biology 2021Quote: ... Arp3-pmCherryC1 [70] was a gift from Christien Merrifield (Addgene plasmid #27682). mEmerald-mDia1-N-14 (Addgene plasmid #54157) ...
-
bioRxiv - Microbiology 2022Quote: ... LV-Lac was a gift from Inder Verma (Addgene plasmid # 12108, (70)) and psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260).
-
bioRxiv - Genomics 2019Quote: ... the 70-80% confluent cells were transfected with 780 ng psPAX2 (Addgene plasmid #12260), 510 ng pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cancer Biology 2022Quote: ... at 70-80% confluency were co-transfected with the lentiviral plasmid and lentiviral helper plasmids (psPAX2: Addgene #12260 and pMD2.G ...
-
bioRxiv - Biophysics 2023Quote: ... Transfections contained 70 ng of SpCas9 nuclease plasmid (pCMV-T7-SpCas9-P2A-EGFP (RTW3027; Addgene ID 139987) and 15 ng each of two sgRNA expression plasmids mixed with 0.3 µL of TransIT-X2 (Mirus ...
-
bioRxiv - Neuroscience 2024Quote: ... stereotactic injection of EnVA-CVS-N2c-dG-H2B-tdTomato (70 nL; dilution 1/10, Addgene plasmid: #175441)19 was performed at P30 in animals previously injected with AAV-3xgRNA-DIO-TVA-N2cG at P0 (80 nl) ...
-
bioRxiv - Microbiology 2020Quote: ... pGEXTK-Pak1 70-117 was a gift from Jonathan Chernoff (Addgene plasmid # 12217; http://n2t.net/addgene:12217; RRID:Addgene_12217)
-
bioRxiv - Neuroscience 2022Quote: ... 70–100 nl of AAV5-CaMKIIa-hChR2(H134R)-EYFP (UNC vector core, Karl Deisseroth virus stock/ Addgene #26969) was injected into either the ventral (AP = −2.8 – −3.1 mm ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells at 70% confluence were transfected with 10 μg of pMRX-IP-GFP-LC3-RFP (#84573, Addgene), 5 μg of VSV.G (#14888 ...
-
bioRxiv - Cell Biology 2023Quote: Cells in a 6-well plate (approximately 70% confluent) were transfected with 0.4ug of an Actin5C-EGFP plasmid (pAc5.1B-EGFP, Addgene #21181) using Effectene Transfection Reagent (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... originally obtained from the laboratory of Sydney Kustu.94 Perturbations of intracellular ppGpp concentrations were performed using a genetic system as described in Büke et al.70 These plasmids (without fluorescent tags) were ordered from AddGene (pRelA’ AddGeneID:175595 ...
-
bioRxiv - Neuroscience 2023Quote: ... method into pDONR221 entry vector and then recombined into a yeast low-copy number CEN destination vector (Addgene, 70) to obtain pAG413-promGPD-WDR47 (pSF634) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The day after when cells reached approximately 70% of confluence they were transfected with 3µg of the PEGFPC1 plasmid (Addgene #28176) using the Viafect reagent (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... unilaterally with 70 nl viral mixture of AAV pCAG-FLEX-{EGFP}on (Addgene plasmid #51502, titer 1.1E+12 GC/ml,) and AAV-{CAR}off (titer 1E+12 GC/ml)104 at 200 µm depth from the bulb surface ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX2TK-Pak1 (70-117) containing the p21-binding domain (PBD) was a gift from Jonathan Chernoff (Addgene plasmid# 12217). For the purification of ARP3 (ACTR3) ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 µg of pH GT1-ademo/dF6 helper and 70 µg of pGP-AAV-syn-jGCaMP7b-WPRE (Plasmid Number 104489, Addgene)56 and mix with 18 ml OptiMEM (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... p118 PB-TRE-dCas9-VPR 70 containing dCas9 fused to VP64-p65-RTA (dCAS9-VPR) transcriptional activators and hygromycin resistance gene (Addgene, #63800) and a plasmid coding for the PiggyBac transposase (kind gift from Valentina Carlini) ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells seeded on 35mm MatTek chambers with 70% confluency were loaded with 1 µg of smFLAG-KDM5B-24×MS2 (Addgene #81084), 0.5 µg of anti-FLAG FB-GFP and 130 ng of purified MCP-HaloTag protein by bead loading (Cialek et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the InterCatch and InterTag sequences were cloned into pSBbi-GP and pSBbi-BP (Kowarz et al. [70]. Addgene #60511 and Addgene #60512) Sleeping Beauty cassettes respectively ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lentiviruses delivering sgRNA were packed by transfecting about 70% confluent HEK293T cells cultured in T75 flasks with 5 µg pCMV-VSVG (Addgene 8454), 10 µg pCMV-dR8.2 dvpr (Addgene 8455) ...
-
bioRxiv - Cell Biology 2022Quote: Guide RNA designed to cut close to the 70-nucleotide region upstream of the ADC17 start codon (agtaacataatgtgctcagcagg) was inserted into pML104 (Addgene number: 67638) to generate pML104-ADC17-70nt ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the InterCatch and InterTag sequences were cloned into pSBbi-GP and pSBbi-BP (Kowarz et al. [70]. Addgene #60511 and Addgene #60512) Sleeping Beauty cassettes respectively ...
-
bioRxiv - Cancer Biology 2023Quote: Oligonucleotides encoding sgRNAs targeting specific genes or non-targeting control sgRNAs (see Supplemental data ‘Oligo sequences’) were cloned into LentiCRISPRv2 vector 70 which was a gift from Feng Zhang (Addgene plasmid # 52961). The resulting vectors were transformed into Endura Chemically Competent Cells according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA FB-SNAP and anti-HA FB-Halo (Addgene #129592), cut by EcoRI and combined with anti-FLAG frankenbody gblocks by Gibson assembly ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-Spike scFv amino acid sequences were obtained from Addgene plasmids #79125 and #155364 ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-HER2 scFv amino acid sequences were obtained from Addgene plasmids #79125 and #85424 ...
-
bioRxiv - Immunology 2022Quote: ... Anti-CD19 and anti-Her2 scFv amino acid sequences were obtained from Addgene plasmids #79125 and #85424 ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLVX-anti-MIR211-5p (Addgene #153318), pLVX-anti-MIR328-3p (Addgene #153319) ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLVX-anti-MIR328-3p (Addgene #153319), and pLVX-Che-zsGreen (Addgene #153320 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vector anti-RBD Sybody (Addgene #153522) was a kind gift from Prof ...
-
bioRxiv - Genetics 2023Quote: ... anti-Na/K-ATPase (1:1000, Addgene #180089) (membrane protein loading control) ...
-
bioRxiv - Immunology 2024Quote: ... VDJ sequences were ordered from IDT and cloned into the vector AbVec antibodies (Addgene)
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Expression vectors encoding Anti-CRISPR proteins were obtained from Addgene: AcrIIA2 (pJH373 plasmid ...
-
bioRxiv - Genetics 2021Quote: CRISPR-Cas and anti-CRISPR plasmids were ordered from Addgene, thanks to gifts from many investigators (Hou et al ...
-
bioRxiv - Cell Biology 2023Quote: ... Then His14-Avi-SUMOEu1-tagged anti-GFP nanobody (Addgene #149336) was immobilized onto the washed magnetic beads for 30 min with mixing at 4°C using a ratio of 27 μg for every 80 μl beads ...
-
bioRxiv - Biochemistry 2022Quote: ... CRISPR sense and anti-sense guides were cloned into pX335 (Addgene plasmid 42335 ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry GST-tagged nanobodies (Addgene #70696, (Katoh et al, 2016)) were expressed and purified according to published protocol (Katoh et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (BL21DE3) expressing GST tagged anti-GFP nanobody (Addgene plasmid #61838) (Katoh et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... purified His14-Avi-SUMOEu1-anti GFP nanobody (expressed from pTP396, Addgene #149336)74 was biotinylated using BirA (expressed from pTP264 ...
-
bioRxiv - Cell Biology 2021Quote: ... The scFv gblocks were ligated with linearized anti-HA frankenbody-mEGFP (Addgene # 129590) by EcoRI through Gibson assembly (anti-FLAG FB-mEGFP) ...
-
bioRxiv - Cell Biology 2022Quote: ... encoding anti-GFP HALO nanobody (a gift from Lennart Wirthmueller, Addgene plasmid #111090) were expressed in bacteria and respectively GST- and His-purified in-house ...