Labshake search
Citations for Addgene :
1 - 46 of 46 citations for Anti SSTR3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... pEGFPN3-SSTR3 (Plasmid #35623, Addgene), pCAGGS-mCherry-ARL13B (Goetz lab) ...
-
bioRxiv - Biophysics 2019Quote: ... The plasmid of GFP-fused SSTR3 was obtained from Addgene (pEF5B-FRT-AP-Sstr3-GFP-DEST ...
-
bioRxiv - Developmental Biology 2020Quote: Other constructs: SSTR3-GFP was a gift from Kirk Mykytyn (Addgene). pRK5-HA-Ubiquitin-WT and pRK5-HA-Ubiquitin-K0 were purchased from Addgene.
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Biophysics 2019Quote: ... The plasmid of GFP-fused SSTR3 was obtained from Addgene (pEF5B-FRT-AP-Sstr3-GFP-DEST, a gift from Maxence Nachury; Addgene plasmid # 49098).57
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA FB-SNAP and anti-HA FB-Halo (Addgene #129592), cut by EcoRI and combined with anti-FLAG frankenbody gblocks by Gibson assembly ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-Spike scFv amino acid sequences were obtained from Addgene plasmids #79125 and #155364 ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-HER2 scFv amino acid sequences were obtained from Addgene plasmids #79125 and #85424 ...
-
bioRxiv - Immunology 2022Quote: ... Anti-CD19 and anti-Her2 scFv amino acid sequences were obtained from Addgene plasmids #79125 and #85424 ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLVX-anti-MIR211-5p (Addgene #153318), pLVX-anti-MIR328-3p (Addgene #153319) ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLVX-anti-MIR328-3p (Addgene #153319), and pLVX-Che-zsGreen (Addgene #153320 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vector anti-RBD Sybody (Addgene #153522) was a kind gift from Prof ...
-
bioRxiv - Genetics 2023Quote: ... anti-Na/K-ATPase (1:1000, Addgene #180089) (membrane protein loading control) ...
-
bioRxiv - Immunology 2024Quote: ... VDJ sequences were ordered from IDT and cloned into the vector AbVec antibodies (Addgene)
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Expression vectors encoding Anti-CRISPR proteins were obtained from Addgene: AcrIIA2 (pJH373 plasmid ...
-
bioRxiv - Genetics 2021Quote: CRISPR-Cas and anti-CRISPR plasmids were ordered from Addgene, thanks to gifts from many investigators (Hou et al ...
-
bioRxiv - Cell Biology 2023Quote: ... Then His14-Avi-SUMOEu1-tagged anti-GFP nanobody (Addgene #149336) was immobilized onto the washed magnetic beads for 30 min with mixing at 4°C using a ratio of 27 μg for every 80 μl beads ...
-
bioRxiv - Biochemistry 2022Quote: ... CRISPR sense and anti-sense guides were cloned into pX335 (Addgene plasmid 42335 ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry GST-tagged nanobodies (Addgene #70696, (Katoh et al, 2016)) were expressed and purified according to published protocol (Katoh et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (BL21DE3) expressing GST tagged anti-GFP nanobody (Addgene plasmid #61838) (Katoh et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... purified His14-Avi-SUMOEu1-anti GFP nanobody (expressed from pTP396, Addgene #149336)74 was biotinylated using BirA (expressed from pTP264 ...
-
bioRxiv - Cell Biology 2021Quote: ... The scFv gblocks were ligated with linearized anti-HA frankenbody-mEGFP (Addgene # 129590) by EcoRI through Gibson assembly (anti-FLAG FB-mEGFP) ...
-
bioRxiv - Cell Biology 2022Quote: ... encoding anti-GFP HALO nanobody (a gift from Lennart Wirthmueller, Addgene plasmid #111090) were expressed in bacteria and respectively GST- and His-purified in-house ...
-
bioRxiv - Molecular Biology 2020Quote: ... A plasmid expressing anti-CRISPR protein (pEJS581; pCSDest2-AcrIIC4Hpa-FLAG-NLS; Addgene # 113436) was included in the triple-transfection packaging process to maintain intact rAAV:HDR:cleaved plasmids during production ...
-
bioRxiv - Molecular Biology 2020Quote: The expression of His14-Avi-SUMOEu1-anti GFP nanobody from plasmid pTP396 (Addgene # 149336) was carried out exactly as described in detail before (Pleiner et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The expression of His14-Avi-SUMOEu1-anti GFP nanobody from plasmid pTP396 (Addgene #149336) was carried out with the following modification ...
-
bioRxiv - Bioengineering 2020Quote: ... Heavy and light chain DNA sequences of antibody fragments (Fab) were purchased from Twist Bioscience and cloned separately into the pHLsec mammalian expression vector (Addgene, #99845) via Gibson assembly ...
-
bioRxiv - Microbiology 2021Quote: ... the antibody component of the SunTag system (pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS45, a gift from Ron Vale, Addgene #60904) was digested with EcoRI+NotI and subcloned into the blunted BamHi site of pCW-TRE ...
-
bioRxiv - Bioengineering 2023Quote: ... To generate the monoclonal IgG1 antibody CSL362 biosimilar MIRG123 the VH and VKL sequences were cloned into AbVec2.0-IGHG1 (Addgene plasmid # 80795) and AbVec1.1-IGKC (Addgene plasmid # 80796) ...
-
bioRxiv - Molecular Biology 2021Quote: The bacterial expression vector for anti-GFP nanobody pGEX-6P-1 was procured from Addgene. E ...
-
bioRxiv - Cell Biology 2021Quote: ... the GST-tagged anti-GFP nanobody construct in pGEX-6P-1 vector (Addgene ID # 61838) was transformed to BL21 RIL (DE3 ...
-
bioRxiv - Biophysics 2023Quote: Anti-EGFP nanobody plasmid (pOPINE GFP) was a gift from Brett Collins (Addgene plasmid #49172)43 and transformed into BL21 cells for purification ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Cell Biology 2022Quote: ... The prokaryote expression vector encoding an anti-GFP mCherry nanobody (a gift from Martin Spiess, Addgene plasmid #109421) and pOPINE GFP nanobody:HALO:His6 ...
-
bioRxiv - Synthetic Biology 2023Quote: A lentiviral transfer plasmid encoding encoding an anti-CD19 synNotch receptor driven by pPGK was acquired from Addgene (pHR_PGK_antiCD19_synNotch_Gal4VP64 was a gift from Wendell Lim ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Molecular Biology 2021Quote: The Mir20b and anti-Mir20b were cloned into the pOTTC385-pAAV CMV-IE IRES EGFP vector (Addgene plasmid # 102936)(Nelson et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2020Quote: The anti-GCN4-scFv was generated from pHR-scFv-GCN4-sfGFP-GB1-dWPRE (Addgene plasmid 60907 (Tanenbaum et al., 2014), cut with EcoRI/XbaI and inserted into pcDNA3 ...
-
bioRxiv - Bioengineering 2024Quote: ... pET28a-SnoopTag-AffiHER2-SpyTag (N-terminal His6–SnoopTag–anti-HER2 Affibody–SpyTag) (GenBank accession no. KU296975) (Addgene deposition in progress) (Brune et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... DNA encoding the SNAP or mSA2 coding region was codon-optimized and synthesized (Integrated DNA Technologies) and cloned in place of the anti-CD19scFv in plasmid pHR-PGK-antiCD19-synNotch-Gal4VP64 (Addgene# 79125) using isothermal assembly ...
-
bioRxiv - Molecular Biology 2020Quote: ... Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336, #149334, #149333) (Pleiner et al. ...
-
bioRxiv - Cell Biology 2023Quote: MDCK cells expressing GFP-Rab19 on the Rab19 KO background were lysed and incubated with GST-tagged anti-GFP nanobody (recombinantly produced from pGEX6P1-GFP-Nanobody, Addgene Plasmid #61838) or with free GST for negative control ...