Labshake search
Citations for Addgene :
1 - 50 of 3276 citations for Adenovirus Type 5 Particles CMV GFP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Immunology 2021Quote: ... pLenti CMV-GFP-TAV2A-LUC Hygro was generated from pLenti CMV GFP Hygro (Addgene #17446) by addition of T2A-Luciferase by PCR cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild-type and Fam134s KO MEFs were infected with pCW57-CMV-ssRFP-GFP-KDEL (Addgene #128257) in order to generate ER-phagy reporter inducible cell lines ...
-
bioRxiv - Cell Biology 2023Quote: ... CMV-LoxP-DsRed-LoxP-GFP was amplified from pLV-CMV-LoxP-DsRed-LoxP-GFP (Addgene #65726) (Zomer et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a WPRE (cloned from pLenti CMV GFP Puro (658-5) (Addgene #17448)) all flanked by epigenetic insulator sequences by repetitive restriction digests (KflI-EcoRI ...
-
bioRxiv - Biophysics 2021Quote: ... CMV-GFP-NMHC IIA (Addgene #11347) and CMV-GFP-NMHC IIB (Addgene #11348 ...
-
bioRxiv - Neuroscience 2019Quote: ... pN1-CMV-TFEB-GFP (Addgene # 38119). Newly cloned episomal plasmids were then additional cloned into lentivector backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC IIA (Addgene #11347) and CMV-GFP-NMHC IIB (Addgene #11348 ...
-
bioRxiv - Molecular Biology 2023Quote: – CMV-Flag-GFP (Addgene plasmid #60360).
-
bioRxiv - Cell Biology 2022Quote: - AoSMC Inducible progerin-expressing cells: Lentiviral particles containing pLenti-CMV-TRE3GNeo-GFP progerin (gift from Tom Misteli (Addgene plasmid # 118710), pLentiCMV-TRE3G-GFP-laminA (gift from Tom Misteli (Addgene plasmid # 118709)) ...
-
bioRxiv - Biophysics 2021Quote: ... and CMV-GFP-NMHC IIB (Addgene #11348) were gifts from Robert Adelstein (Wei and Adelstein ...
-
bioRxiv - Microbiology 2022Quote: ... The pLenti-CMV-GFP-Puro (Addgene, 17448), pLenti-CMV-Luc-Puro (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... and CMV-GFP-NMHC IIB (Addgene #11348) were gifts from Robert Adelstein (Wei and Adelstein ...
-
bioRxiv - Genomics 2023Quote: pLenti CMV GFP Puro (Addgene, plasmid #17448) plasmid was cut with BsrgI and SalI restriction enzymes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transposon plasmid (PT4-CMV-GFP (Addgene #11704), PT4-U6-sgRNA-CMV-GFP ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and transfer (pHR-CMV-GFP, Addgene #14858) plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... pTrip-CMV-GFP-Flag-cGas (Addgene 86675); pLBS.CAG-NLS-mScarlet (Addgene 129336) ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448 ...
-
bioRxiv - Bioengineering 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (RRID:Addgene_17448)[33] ...
-
bioRxiv - Cell Biology 2021Quote: ... Exogenous cells - MDCK cells were mosaically transfected using a CMV GFP vector (pLenti CMV GFP Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17445 ...
-
bioRxiv - Microbiology 2022Quote: ... and pLenti CMV Puro GFP (Addgene plasmid #17448) vectors were a gift from Eric Campeau and Paul Kaufman [84] ...
-
bioRxiv - Neuroscience 2023Quote: pAAV-CMV-Cre-GFP was obtained from Addgene Cat No ...
-
bioRxiv - Cancer Biology 2023Quote: ... + pLenti-CMV-GFP-Neo (657-2) GFP expression vector (Addgene, Plasmid 17447). All cells were cultured with RPMI 1640 media ...
-
bioRxiv - Immunology 2020Quote: We using the 3*Flag sequence to replace the GFP protein in the pLenti CMV GFP Puro vector (Addgene, 658-5) for adding some Restriction Enzyme cutting site (XbaI-EcoRV-BstBI-BamHI ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus was constructed by subcloning the existing E-cadherin tension sensor into the pShuttle-CMV vector (Addgene, 16403), followed by recombination into the pAdEasy1 vector (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: Lentiviral particles from plentiCRISPRv2 and retroviral particles from pBabe-hygro-GFP (RRID:Addgene_61215) were produced in 293T cells as described26,27 ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
bioRxiv - Bioengineering 2022Quote: ... and the pLenti-CMV-GFP-Puro plasmid (Addgene #17448) as previously described [66] ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid 73582).
-
bioRxiv - Cell Biology 2024Quote: ... Transient expression of CMV-GFP-NMHC-IIA (Addgene #11347) and mCherry-MyosinIIB-N-18 (Addgene #55107 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Bioengineering 2020Quote: ... lentivirus encoding GFP was produced using plasmid for GFP expression (CMV-GFP) purchased from Addgene (Cambridge MA). Transduction was carried out using CMV-GFP lentiviruses in growth media with 8 μg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... The H2B-GFP fragment was amplified from the CMV-H2B-GFP (Addgene plasmid #11680) plasmid using the following primers ...
-
bioRxiv - Cancer Biology 2019Quote: pLenti CMV GFP Puro was purchased from Addgene (Watertown, MA).
-
bioRxiv - Molecular Biology 2022Quote: ... pLenti-CMV-GFP-Puro plasmid was obtained from Addgene (17448). Plasmid p3XFLAG -CMV-7.1 was obtained from Sigma (E7533).
-
bioRxiv - Cell Biology 2024Quote: ... HEK293 cells transfected with either cmv-gfp (control; Addgene 11153) or cmv-CAPS-FLAG were plated in a 96-well plate ...
-
bioRxiv - Neuroscience 2021Quote: AAV9-particles were synthesized usingpAAV-U6-sgRNA-CMV-eGFP and pAAV-RSV-spCas9 (Addgene plasmids #85451 and 85450 ...
-
Contractile acto-myosin network on nuclear envelope remnants positions human chromosomes for mitosisbioRxiv - Cell Biology 2019Quote: ... & MHC-GFP (pT3153, CMV-GFP-NMHC II-A, a gift from Robert Adelstein, AddGene #11347). For transfection of plasmids ...
-
bioRxiv - Immunology 2019Quote: pLenti-CMV-GFP (pLU) vector was acquired from Addgene (Cambridge, MA). CMV promoter was replaced by EF1a promoter to improve the expression of the encoded gene in human T cells ...
-
bioRxiv - Cell Biology 2023Quote: 1205Lu cells stably expressing pTrip-CMV-GFP-Flag-cGas (Addgene 86675) and pLBS.CAG-NLS-mScarlet (Addgene 129336 ...
-
bioRxiv - Bioengineering 2019Quote: cDNA for pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #1744856). To generate lentivirus ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: RNH1-KO K562 cells were infected with lentiviruses expressing ANG (pLenti CMV Blast GFP-ANG) or the empty vector pLenti CMV Blast DEST (706-1, Addgene) as previously described 52 ...
-
bioRxiv - Cell Biology 2022Quote: ... T2A-GFP fragment was amplified by T2A-F and GFP-R primers using plenti-CMV-mCherry-T2A-GFP (Addgene plasmid #109427) as a template ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHCII-A was a gift from Robert Adelstein (Addgene #11347). ARP3-mCherry (Addgene #27682 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... For assessing transduction efficiency a CMV-GFP-Puro-expressing lentivirus (Addgene #17448) was used at MOI=1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were cloned into the transposon vector PT4-CMV-GFP (Addgene #117046) and amplified as described in90 ...
-
bioRxiv - Molecular Biology 2021Quote: ... CasRx-GFP lentiviral particles were produced by co-transfecting plasmids encoding CasRx-GFP (PXR001; Addgene) with VSV-G envelope (pMD2.G ...
-
bioRxiv - Neuroscience 2021Quote: ... adenovirus helper plasmid pAdDeltaF6 (Addgene 112867) and pAAV-hSyn-EGFP (Addgene 50465) ...