Labshake search
Citations for Addgene :
1 - 50 of 1398 citations for AKT1 2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Akt1 (Addgene #86631), Akt1T308A (Addgene #49189) ...
-
bioRxiv - Cancer Biology 2019Quote: ... respectively (pHRIG-Akt1 (Addgene plasmid #53583) was a gift from Heng Zhao [66]) ...
-
bioRxiv - Cell Biology 2020Quote: Wild type AKT1 plasmid was purchased from Addgene (Addgene plasmid pcDNA3-myr-HA-AKT1 1036). Point mutation as in references (37 ...
-
bioRxiv - Cell Biology 2020Quote: Wild type AKT1 plasmid was purchased from Addgene (Addgene plasmid pcDNA3-myr-HA-AKT1 1036) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 901 pLNCX myr HA Akt1 (Addgene, Cat #9005) was used for transient overexpression of active AKT ...
-
bioRxiv - Immunology 2023Quote: ... pCDNA3-HA-Akt1-aa1-149 (Addgene plasmid # 73410, RRID:Addgene_73410), pCDNA3-HA-Akt1-aa1-408 (Addgene plasmid # 73412 ...
-
bioRxiv - Immunology 2023Quote: ... pCDNA3-HA-Akt1-aa1-408 (Addgene plasmid # 73412, RRID:Addgene_73412) and pCDNA3-HA-Akt1-aa120-433 (Addgene plasmid # 73411 ...
-
bioRxiv - Immunology 2023Quote: ... pCDNA3-HA-Akt1-aa1-408 (Addgene plasmid # 73412, RRID:Addgene_73412) and pCDNA3-HA-Akt1-aa120-433 (Addgene plasmid # 73411 ...
-
bioRxiv - Immunology 2023Quote: ... pCDNA3-HA-Akt1-aa1-149 (Addgene plasmid # 73410, RRID:Addgene_73410), pCDNA3-HA-Akt1-aa1-408 (Addgene plasmid # 73412 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Myr-Akt1 and RFP-GGA1-NGAT were purchased from Addgene. LRP1-EGFP was a kind gift from S ...
-
bioRxiv - Immunology 2023Quote: ... and pCDNA3-HA-Akt1-aa120-433 (Addgene plasmid # 73411, RRID:Addgene_73411). These plasmids were a gift from Jie Chen (University of Illinois at Urbana-Champaign ...
-
bioRxiv - Immunology 2023Quote: ... and pCDNA3-HA-Akt1-aa120-433 (Addgene plasmid # 73411, RRID:Addgene_73411). These plasmids were a gift from Jie Chen (University of Illinois at Urbana-Champaign ...
-
bioRxiv - Molecular Biology 2021Quote: pcDNA3.1-HA-AKT1 vector was purchased from Addgene (#9008, MA, USA); pEZ-M56-14-3-3γ-mCherry ...
-
bioRxiv - Immunology 2023Quote: ... with the following plasmids: pCDNA3-HA-Akt1 (Addgene plasmid # 73408, RRID:Addgene_73408), pCDNA3-HA-Akt1-aa1-149 (Addgene plasmid # 73410 ...
-
bioRxiv - Immunology 2023Quote: ... with the following plasmids: pCDNA3-HA-Akt1 (Addgene plasmid # 73408, RRID:Addgene_73408), pCDNA3-HA-Akt1-aa1-149 (Addgene plasmid # 73410 ...
-
bioRxiv - Biochemistry 2022Quote: ... site-directed mutagenesis was conducted on pcDNA3-HA-Akt1-K179M (Addgene plasmid #73409) and pcDNA3-SGK1-V5-6xHis to change their original tags into FLAG tag ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA3 Myr HA AKT1 plasmid was purchased from Addgene (ID 9008, RRID:Addgene_9008), which was originally established by Dr William Sellers (41) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pHAGE-AKT1-E17K was a gift from Gordon Mills & Kenneth Scott (Addgene plasmid # 116103).
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genetic depletion of mouse RhoA or AKT1 in vivo was conducted using pSECC (#60820; Addgene, Watertown, MA, USA), a lentiviral-based system that combined both the CRISPR system and Cre recombinase ...
-
bioRxiv - Cancer Biology 2023Quote: Human AKT1_D274A was generated by overlapping PCR mutagenesis using wild-type AKT1 (a gift from Thomas Leonard, Addgene plasmid 8656133) and cloned into a pAceBac1 vector with N-terminal His10-StrepII-(tev ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-CMV-AktE17K-Hygro was generated by replacing GFP in pLenti-CMV-GFP-Hygro with AKTE17K cDNA from pFBD-Akt1(E17K) (Addgene plasmid #86563). pLenti-CMV-Fosl1-Hygro was generated by replacing GFP in pLenti-CMV-GFP-Hygro with Fosl1 cDNA from mouse embryonic fibroblasts (MEF) ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmids coding for pHRIG-Akt1 (Akt-CA) and pHRIG-AktDN (Akt-N) were gifts from Heng Zhao (Addgene plasmids #53583 and 53597 respectively). MAP2-GFP was previously described (Liot et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RPA 2 and 3 were cloned into 11A vectors (Addgene: 48294), followed by assembly of all RPA subunits into one vector by successive ligation independent cloning reactions ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cell Biology 2023Quote: Plasmids encoding recombinant WT (RRID:Addgene_92100) and M880A mutant human GST-TAF3-PHD were kindly provided by Albert Jeltsch (Kungulovski et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant strains harbouring pTEC19 plasmid (Addgene, #30178) and producing the fluorescent protein E2-Crimson were grown in Middlebrook 7H9 broth supplemented with 0.2% glycerol (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...