Labshake search
Citations for Addgene :
1 - 50 of 1545 citations for 8 8 dimethylpyrano 2 3 h chromen 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Pathology 2023Quote: ... pAAV2/8 (Addgene 112864 deposited by Dr Wilson ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Biochemistry 2021Quote: ... 8 μg psPAX2 (#12260, Addgene) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10μg pAAV2/8 (Addgene #112864) and 20μg pAdDeltaF6 (Addgene #112867 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cargo RNA expression plasmids for mCherry-MS2×8 and Cre-MS2×8 were pFH2.22 (Addgene, #205537) and pJAM1.52 ...
-
bioRxiv - Genomics 2022Quote: ... pAAV2/8 Rep/Cap plasmid (Addgene, plasmid #112864 ...
-
bioRxiv - Genetics 2019Quote: ... and 8 μg of psPAX2 (Addgene) plasmid per 100 mm dish by using JetPRIME (PolyPlus ...
-
bioRxiv - Microbiology 2022Quote: ... 8 µg pMDL (Addgene plasmid: 12251), 4 µg VSVg ...
-
bioRxiv - Biochemistry 2022Quote: pCS2+8 empty vector (Addgene: #34931)
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127 ...
-
bioRxiv - Molecular Biology 2023Quote: ... AAVMYO2 (8) or AAVMYO3 (8)) and pAdDeltaF6 helper (a gift from J. M. Wilson Addgene, plasmid # 112867) plasmid using PEI MAX (Polyscience) ...
-
bioRxiv - Cell Biology 2021Quote: ... 7 and 8 were ordered from Addgene. The plasmids ordered were HDAC2 Flag (Addgene plasmid # 36829 ...
-
bioRxiv - Biochemistry 2022Quote: pCS2+8 empty vector (e.g., Addgene #34931)
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The empty pCS2+8 vector (Addgene #34931) was from Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179 ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene ...
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (Addgene, AV-8-PV1091) were injected via tail vein at a dose of 1×1012 genomic copies per mouse on GD8 ...
-
bioRxiv - Immunology 2023Quote: ... were transfected with the above retroviral plasmids encoding the 8-24 or 8-DN TCRβ transgene and the pCL-Eco packaging vector (Addgene) using Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... hM4Di (AAV2/8-Syn-DIO-hM4DI-mCherry; Addgene), AAV2/9-EF1α-dio-ChR2(E123A)-EYFP-WPRE-hGH (channelrhodopsin ...
-
bioRxiv - Neuroscience 2022Quote: - AAV-hSyn-DIO-mCherry (Addgene 50459, serotype 8), here referred to as AAV-DIO-mCherry ...
-
bioRxiv - Physiology 2022Quote: ... The AAV2/8-hSyn-DIO-hM3Dq-mCherry (Addgene plasmid 44361 ...
-
bioRxiv - Physiology 2022Quote: ... AAV8-TBG-Null virus (Addgene, AV-8-PV0148) was used as a control.
-
bioRxiv - Biochemistry 2022Quote: ... Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) was cloned in pET15b with N-terminal 6xHis and C-terminal StrepII tags ...
-
bioRxiv - Cell Biology 2023Quote: ... donor constructs were: AICSDP-8:TOMM20-mEGFP (Addgene plasmid #87423 ...
-
bioRxiv - Biochemistry 2023Quote: Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) and human dynamin2 C-terminally tagged to mCherry were cloned in pET15b with an N-terminal 6xHis and a C-terminal StrepII tag ...
-
bioRxiv - Genetics 2023Quote: ... the rep/cap hybrid plasmid pAAV2/8 (Addgene #112864 ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/8-Syn-dio-mCherry in vCA1 (control, Addgene), hM4Di (AAV2/8-Syn-DIO-hM4DI-mCherry ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/8 hSyn-DIO-mCherry (Addgene, 2.5E13 GC/ml)
-
bioRxiv - Developmental Biology 2023Quote: ... pCS2+8 was a gift from Amro Hamdoun (Addgene plasmid #34931 ...
-
bioRxiv - Physiology 2022Quote: ... Maternal hepatocyte-specific YAP1 deletion was achieved by injecting mice with the adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (AAV8-TBG-Cre virus, Addgene, AV-8-PV1091) via tail vein at a dose of 1×1012 genomic copies/mouse ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...