Labshake search
Citations for Addgene :
1 - 50 of 1459 citations for 7 CHLORO 10 11 DIHYDRO 5H DIBENZ B F ACEPIN 2 OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... mEmerald-Vimentin-7 and F-tractin-EGFP were gifts from Michael Davidson (Addgene; 54299) and Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... were secured in a stereotaxic frame and unilateral or bilateral injections of fluorogold or choleratoxin B subunit tracers dissolved in glycerol (FG 2% iontophoresis by 2 µA pulses with 2/2 s on/off duty cycle for 5 minutes and CTB 0.5% iontophoresis by 5 µA pulses with 2/2 s on/off duty cycle for 7-10 minutes) or retrograde pAAVrg-CAG-GFP (Addgene: 37825-AAVrg) or retrograde AAVrg-EF1a-mCherry-IRES-Flpo (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-CAG-GFP (Addgene, 7×10^12 gc/ml), AAV2-retro-AAV-CAG-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml, Addgene) viruses were injected with a 10μl Neuros syringe (Hamilton ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-AAV-CAG-tdTomato (Addgene, 7×10^12 gc/ml), Cholera toxin subunit B CF-640 (Biotium ...
-
bioRxiv - Neuroscience 2023Quote: ... 7×10¹² genome copies per ml) viruses were purchased from Addgene.
-
bioRxiv - Cell Biology 2020Quote: ... specifically: pETM-11 (AddGene) for Sar1 and pFASTBacHTb (AddGene ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pSFFV_mNG2(11)1-10 plasmid was a gift from Bo Huang (Addgene plasmid # 82610) (Feng et al. ...
-
bioRxiv - Neuroscience 2020Quote: [2] QF2-Hsp70 from pattB-synaptobrevin-7-QFBDAD-hsp70 (Addgene plasmid #46115) (Primers ...
-
bioRxiv - Neuroscience 2021Quote: U118-MG astrocytoma cells were transfected with the F-actin marker mCherry-LifeAct-7 plasmid (gift from Michael Davidson, Addgene #54491) using a calcium phosphate precipitation protocol.24 LifeAct-7 is a 17 amino acid peptide that binds to the actin cytoskeleton ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL of AAVrg-hSyn-GFP (Addgene 50465-AAVrg; titer 7×10^12 vg/mL) was injected unilaterally at a rate of 2nL/sec ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; virus titer ≥ 7×10¹² vg/mL) viruses were performed on adult anesthetized (isoflurane ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.1 µL of AAV2-pCAG-FLEX-eGFP (Addgene #51502; titer: 7×10¹² vg/mL) was injected into the SNr during the same surgery ...
-
bioRxiv - Biophysics 2021Quote: ... The gp67-438-B modified from 438-B (Addgene) was used to express recombinant secretory proteins.
-
bioRxiv - Cell Biology 2024Quote: ... the full f-tractin-mCherry coding sequence (from C1-F-tractin-mCherry, Addgene #155218) was subcloned into the lentiviral expression vector pLVX-M-puro (Takara 632164) ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL total of AAVrg-hSyn-GFP (Addgene 50465-AAVrg; titer 7×10^12 vg/mL) was unilaterally injected at a rate or 2 nL/sec into the mPFC (100 nL in IL ...
-
bioRxiv - Neuroscience 2024Quote: ... RLAs received AAV5-hSyn-DOI-hM4D(Gi)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44362). As a control ...
-
bioRxiv - Neuroscience 2023Quote: Anterograde transsynaptic expression was done with AAV1-cre (AAV1.CamKII0.4.Cre.SV40, 7×10¹² vg/mL, Addgene). Retrograde transsynaptic expression was performed with starter vector (AAV-DIO-Ef1a-TVA-FLAG-2A-N2C_G ...
-
bioRxiv - Neuroscience 2024Quote: ... RHAs received AAV5-hSyn-DOI-hM3D(Gq)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44361). Conversely ...
-
bioRxiv - Neuroscience 2024Quote: ... an anterograde Cre-dependent AAV5-hSyn-DOI-hM4Di-mCherry (7×10¹² vg/mL, plasmid #44362, Addgene) for RLA rats (hM4Di-group ...
-
bioRxiv - Neuroscience 2024Quote: ... or an anterograde Cre-dependent AAV5-hSyn-DOI-mCherry (7×10¹² vg/mL, plasmid #50459, Addgene) for control groups (mCherry control groups ...
-
bioRxiv - Biophysics 2021Quote: ... and 11 μg packaging plasmid (psPAX2; Addgene #12260) using PEI at 2.5:1 (w/w ...
-
bioRxiv - Microbiology 2022Quote: ... and 11 μg of pMDLg/pRRE (Addgene # 12251) were co-transfected per tissue culture dish using Lipofectamine LTX reagent with PLUS reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... A cohort of SOM.iPKR and PKCδ.iPKR mice were injected with bilaterally in CeL with 200 nl of AAV.Eef1a1 Pr.DIO.EGFPL10a (7 × 10^^12 GC/ml, Addgene) for immunohistochemistry experiment; ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1 ...
-
Autoimmune inflammation triggers aberrant astrocytic calcium signaling to impair synaptic plasticitybioRxiv - Neuroscience 2023Quote: ... IP3R2-KO and CB f/f mice were injected with AAV5-pZac2.1-gfaABC1d-cyto-GCaMP6f (Addgene), AAV-5/2-hGFAP-hM3D(Gq)/hM4D(Gi)_mCherry-WPRE-hGHp(A ...
-
bioRxiv - Cell Biology 2024Quote: ... F-tractin and Linker 1 were derived from pEGFP-C1 F-tractin-EGFP (Addgene Plasmid #5847)48 ...
-
bioRxiv - Cell Biology 2023Quote: ... Homology arms were cloned into pDD268 [11] (Addgene #132523) using NEBuilder Hifi DNA assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1; http://n2t.net/addgene:50465; RRID:Addgene_50465) were injected into the dorsolateral (100-200 nl ...
-
bioRxiv - Immunology 2019Quote: ... or with 2 µg of plasmid DNA encoding either F-tractin-GFP (Johnson and Schell, 2009) or myosin IIA-GFP (Addgene, #38297) (Jacobelli et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids mIFP12-Rab4a-7 (#56261) and mIFP-Golgi-7 (#56221) were purchased from Addgene.
-
bioRxiv - Genetics 2020Quote: The primers ABEmax-F/ABEmax-R and AncBE4max-F/ AncBE4max-R was used to amplified pCMV_ABEmax_P2A_GFP (Addgene #112101) and pCMV_AncBE4max (Addgene #112094 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-7:SEC61B-mEGFP (Addgene plasmid # 87426 ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or EGFP (pQCXIP-EGFP-F, Addgene #73014). MIA PaCa-2 WT-RFP were mixed 1:1 with TSC1/TSC2 KO-GFP cells ...
-
bioRxiv - Cell Biology 2023Quote: ... and C1-F-tractin-mCherry (Addgene; 155218), respectively ...
-
bioRxiv - Neuroscience 2023Quote: Adult mice were stereotaxically injected at 7-10 weeks of age with 600 nl of 1.5×1013 vg/ml AAV1-CKIIa-stGtACR2-FusionRed (AddGene) or 7×1012 vg/ml AAV1-CKIIa-mCherry control at bilateral ACC (antero-posterior (AP ...
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...