Labshake search
Citations for Addgene :
1 - 50 of 2444 citations for 6H dibenz C E 1 2 oxaphosphorin 6 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plasmid E[beta]C (Addgene cat. no. 24312) was used ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898 ...
-
bioRxiv - Cancer Biology 2023Quote: ... E-cadherin reporter (pHAGE-E-cadherin-RFP, Addgene #79603), cell cycle reporter (pBOB-EF1-FastFUCCI-Puro ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Neuroscience 2023Quote: ... pET22b-6h-GST-TEVp was digested with BamHI and XhoI restriction enzymes in order to remove TEVp gene (Addgene plasmid #172887). α-synuclein was cloned into pET22b-6h-GST backbone by Gibson assembly method ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898; http://n2t.net/addgene:153898; RRID:Addgene_153898). MLV-gag/pol ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-E-Syt1(Addgene #66830), EGFP-JPH3 and EGFP-VAP-B ...
-
bioRxiv - Microbiology 2023Quote: ... M and E (Addgene 177938); and S (D614G N501Y ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Cell Biology 2020Quote: ... PA28γ ORF WT or minus the C-terminal 14 amino acids (ΔC) were cloned into pSBbi-Pur (a gift from E. Addgene plasmid #60523) according to (Kowarz et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... The U6.3>gRNA.f+e (#99139, Addgene) vector was digested over night with BsaI-HF enzyme (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... gRNA expression vectors U6.3> gRNA.f+e and U6.3> Control.gRNA.f+e were obtained from Addgene (Gandhi et al., 2017). Oligo DNAs for the gRNA templates were designed as follows (lowercase letters indicate BsaI overhang) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sgRNA pair targeting the IKZF3 gene locus was designed using E-CRISP website (http://www.e-crisp.org/E-CRISP/) and expressed from pGL3-U6 sgRNA-PGK-Puro vector (Addgene 51133).
-
bioRxiv - Cell Biology 2020Quote: ... The construct pT2-CAG-GFP-E-Syt1 was generated by restriction digestion of the EGFP-E-Syt1 (Addgene #66830) and the pT2-CAG-fGFP plasmids with AgeI and MluI ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF5C(1-560)-2xmCh-EF(C) (Addgene #61664) and KIF5C(1-560)-mCit (Addgene #61676 ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Microbiology 2023Quote: ... The CoV2-M-IRES-E (Addgene plasmid # 177938), Luc-T20 (Addgene plasmid # 177941 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... membrane and envelope (CoV2-M-IRES-E, Addgene), and spike (nCoV-2-B117 or B117/M1237I ...
-
bioRxiv - Cell Biology 2022Quote: ... with AgeI and BstBI restriction sites into the pLenti CMV/TO GFP-MDC1 (779-2) (plasmid #26285, Addgene, gift from E. Campeau; Genewiz) backbone ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453 ...
-
bioRxiv - Molecular Biology 2023Quote: ... are a derivative of HEK293T-E with a second-generation lentiviral vector generated with the pCW57-E-IRES-ORF6 (Addgene plasmid #80921) as a transfer vector ...
-
bioRxiv - Neuroscience 2021Quote: ... E Dent include the plasmids EB3 tdTomato (Addgene #50708) and the plasmid encoding DsRed2 (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Cag-Egfp-Apobec1-Yth (E-Yth, Addgene #209319), pAAV-Cag-Egfp-Apobec1-Ythmut(E-Ythmut ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Cag-Apobec1-Ythmut-Egfp (Ythmut-E, Addgene #209323), pAAV-Cag-Apobec1-Egfp (Addgene #209324 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Cag-Egfp-Apobec1-Ythmut(E-Ythmut, Addgene #209320) and pAAV-Cag-Egfp-Apobec1 (Addgene #209321) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two crRNAs introduced into lentiviral vectors (pLentiCRISPR-E, Addgene #78852) which contains eSpCas9 and puroMYCin cassette.
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have combined them all in a pX330A-dCas9 1×6 (Plasmid #63600, Addgene). Cloning of oligonucleotides was confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...