Labshake search
Citations for Addgene :
1 - 50 of 2967 citations for 6H Pyrrolo 1 2 1 2 imidazo 4 5 f 2 1 3 benzoxadiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Biochemistry 2020Quote: ... which were cloned into pX330A-1×2 (Addgene #58766) and combined with pX330A-2-PITCh (Addgene #63670 ...
-
bioRxiv - Neuroscience 2024Quote: ... A 1:2 viral mixture of pENN.AAV.CamKII 0.4.Cre.SV40 (Addgene, diluted 1:100,000) and pAAV-hSyn-DIO-EGFP (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ...
-
bioRxiv - Neuroscience 2023Quote: Burrhole injections of viral constructs [rAAV2/1&2.hSyn.SIO-eOPN3-mScarlet (Addgene 125713 diluted to 6 × 1012 viral genomes/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of each plasmid pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (Addgene #27078) ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Genetics 2019Quote: pCFD3-frame_selector_(0, 1, or 2) plasmids (Addgene #127553-127555, DGRC #1482-1484) were cloned by ligating annealed oligos encoding sgRNAs that target the CRISPaint target site (Schmid-Burgk et al ...