Labshake search
Citations for Addgene :
1 - 50 of 2604 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg Cas9 expression plasmid pSpCas9(BB)-2A-Puro (Addgene, PX459) was stably transfected into 8×105 DBA/2 ES cells via electroporation ...
-
bioRxiv - Cancer Biology 2021Quote: ... eSpCas9-2A-GFP was constructed by subcloning 2A-GFP from pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) into eSpCas9 using EcoRI sites ...
-
bioRxiv - Neuroscience 2021Quote: ... pyogenes with 2A-EGFP pSpCas9 (BB)-2A-GFP (PX458) (Addgene plasmid # 48138 ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... Figs. 4A-C, 5, and 7B,C, and Supplementary Movies 1,2; Salk Vector Core; 2.5 x 1012; Addgene plasmid #50973); AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... CMYC cds (Addgene #46970), KRAS4B G12V cds (Addgene #35633) ...
-
bioRxiv - Genomics 2023Quote: ... or ZIM3-dCas9-2A-puro-2A-GFP (200ng) and pCFD3 (Addgene, 49410) (200ng ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 μg of episomal pCXLE-Sox2A61V-2A-Klf4-2A-Myc (Addgene #210017) and 3 μg of pCXWB-EBNA1 (Addgene #37624 ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Genetics 2021Quote: ... inserting the ALKBH5 CDS and mRuby3 CDS into the pLIX_403 vector (Addgene plasmid #41395). The linker region between ALKBH5 and mRuby3 was constructed manually by finding the consensus at each position for reads mapping to the end of the ALKBH5 CDS or the start of the mRuby3 CDS ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Pathology 2019Quote: ... gRNA_ex93.0: 5’-GCGTGAGGACAACCGCGTGCAGG-3’) were cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene 48138) and introduced into CRL1502 iPSCs by reverse transfection using TransIT-LT1 (Mirus Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... KRAS4B G12V cds (Addgene #35633), p53 R175H or R273H cds (a gift from Dr Maciej Olszewski ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Developmental Biology 2022Quote: ... pCAGGS-Cas9-2A-mRFP was generated by inserting Cas9-2A derived from pCAG-Cas9-2A-Citrin (obtained from Addgene; Williams et al., 2018) into pCAGGS-mRFP by In-Fusion Cloning with the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μL of AAV9-hsyn-cre-2a-tdT (Addgene#107738, titer ∼1×10^13) was diluted with 3 μL of PBS and was injected into the subarachnoid space of one hemisphere at the level of somatosensory cortex in Mtor-floxed-5XFAD mice ...
-
bioRxiv - Cell Biology 2020Quote: pSpCas9(BB)-2A-mCherry was generated from pSpCas9(BB)-2A-GFP (Addgene, plasmid #48138) by removing EGFP and the T2A sequence via EcoRI digestion ...
-
bioRxiv - Neuroscience 2024Quote: ... p3E-2A-mcherrypA (Addgene, 26031), and pDESTtol2pACryGFP (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... and pcDNA3.1-MS2-Tet1-CD (Addgene) plasmids using Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2A-mCherry-loxP-Neo-loxP fragment was cloned from Nanog-2A-mCherry plasmid (Addgene #59995). The different fragments were then cloned to pUC19 plasmid to make the complete donor plasmids for both knockin experiments ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plasmid with mCherry-2A-rTetR-CBX7 was created by subcloning mCherry-2A-rTetR (Addgene # 78101)14 and CBX7 into lentiviral expression vector backbone pLVU-tTR-KRAB (Addgene# 11645)71 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2A-mCherry-loxP-Neo-loxP fragment was cloned from Nanog-2A-mCherry plasmid (Addgene # 59995). The different fragments were then cloned to a modified pUC19 plasmid with additional restriction sites inserted ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Neuroscience 2021Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 and pSpCas9(BB)-2A-GFP (PX458) were purchased from Addgene. Custom oligonucleotides were generated (GluN2A forward ...
-
bioRxiv - Molecular Biology 2021Quote: RfxCas13d-2A-GFP was expressed using the plasmid pXR001: EF1a-CasRx-2A-EGFP (Addgene #109049, ref4). In the competitive growth assay described in Fig ...
-
bioRxiv - Molecular Biology 2020Quote: ... pSpCas9n(BB)-2A-GFP (PX461) (Addgene plasmid # 48140 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... pSpCas9(BB)-2A-Puro (Addgene #48139) using Lipofectamine LTX & Plus Reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... pSpCas9(BB)–2A–Puro (62988, Addgene). The resulting plasmid was transfected into the wild-type human iPSCs using Lipofectamine (CMAX00015 ...
-
bioRxiv - Immunology 2022Quote: ... dCas9-VP64-2A-GFP (Addgene 61422) and pHR-SFFV-dCas9-BFP-KRAB (addgene 46911 ...
-
bioRxiv - Cell Biology 2024Quote: ... (Addgene #48138 for single cell sorting or pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) for puromycin selection (Ran et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... pSPCas9n-2A-GFP (pSpCas9n(BB)-2A-GFP (PX461)) was a gift from Feng Zhang (Addgene plasmid #48140) [44] ...
-
bioRxiv - Microbiology 2022Quote: ... coli DH10Bac cells following transformation with the pFastBac LIC cloning vector (4A) (Addgene #30111) containing a cloned copy of the AAV4 VP1 gene ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...
-
bioRxiv - Genetics 2024Quote: ... 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279), and 1 μg of one of six spike proteins tested.