Labshake search
Citations for Addgene :
1 - 50 of 1795 citations for 6 chloro 4 methyl 2 phenylimino benzo b thiophen 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The gp67-438-B modified from 438-B (Addgene) was used to express recombinant secretory proteins.
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Developmental Biology 2019Quote: ... Two oligos encoding guide RNA sequences that targeted either exon 3 (5’-GGCTTCGACAAGGCCGAGGG −3’) or exon 4 (5’-GATCTGATCACGACGTGTTA −3’) were inserted into the BbsI site of pU6-BbSI-gRNA (Addgene). Each gRNA construct was independently injected into BDSC Stock 52669 (y1 M{vas-Cas9.S}ZH-2A w1118 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RPA 2 and 3 were cloned into 11A vectors (Addgene: 48294), followed by assembly of all RPA subunits into one vector by successive ligation independent cloning reactions ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or ddGFP-B (Addgene, 40287). cDNAs for the PAR binding domains were amplified from previously published pET19b constructs (Gibson et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509 ...
-
bioRxiv - Immunology 2024Quote: ... and B (AUC = 0.61, Addgene) respectively (Fig S10i) ...
-
bioRxiv - Molecular Biology 2020Quote: ... These cells were spin transfected for 2h at 1000g with 82*10E6 Brunello virus particles (LentiCRISPRv2, Addgene 73179-LV ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...