Labshake search
Citations for Addgene :
1 - 50 of 1176 citations for 6 Quinoxalinamine N ethyl 2 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Neuroscience 2022Quote: ... between the age of P60 and P120 (n = 6) were injected with virally encoded Cre-dependent GCaMP in PFC (~300 nl, AAV2/9 flex GCaMP6f, Addgene) and Cre in LEC (140 nl at each site ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either the inhibitory opsin archaerhodopsin T (ArchT; N = 11; 6 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Neuroscience 2023Quote: ... University of North Carolina Vector Core) or an enhanced yellow fluorescent protein control (eYFP; N = 13, 6 males; pAAV5-Ef1a-DIO-eYFP, Addgene). Virus (0.2 µl ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice were generated by subcloning an N-terminal 3x HA-tagged CIC-DUX4 fusion gene from Yoshimoto et al.6 into a Rosa26 targeting construct (Addgene #21714). The sequence verified construct was then transfected into ES cells and selected in G418 media ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Microbiology 2021Quote: ... N (Addgene # 64087), P (Addgene # 64088) ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ; http://n2t.net/addgene:57461; RRID:Addgene_57461). CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ...
-
bioRxiv - Bioengineering 2021Quote: ... the sequence encoding the PE2 N terminus (PE2-N term) (Addgene #132775) and a splicing donor (SD ...
-
bioRxiv - Cancer Biology 2021Quote: ... N-Myc (Addgene #74163) was cloned into plasmid pcDNA5/FRT/TO (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Molecular Biology 2021Quote: ... N-terminal FKBP12F36V fragments were originally amplified originally from pLEX_305-N-dTAG (Addgene #91797) (Nabet et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro (a kind gift from Neven Krogan, available from Addgene #141391) with PEI ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 virus-like particles were prepared as previously described (68) by co-transfecting plasmids for N (Addgene 177937); M and E (Addgene 177938) ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transiently co- transfected for 24 h with plasmids for expression of full-length, N-terminal tagged (Flag, HA or tandem Strep tag) BRSK1/2 (or Cys-Ala mutants) and GFP-TAU (Addgene), using 3:1 polyethylenimine (average Mw ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S) (Addgene 29659, a gift from Scott Gradia) using the HiFi Assembly kit (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3-N-HA-NEK7 and pcDNA3-N-HA-NEK7K64M were gifts from Bruce Beutler (Addgene plasmid # 75142 ...
-
bioRxiv - Biophysics 2022Quote: ... NCBI Accession YP_009820873.1) were cloned with an N-terminal TEV protease-cleavable His6-tag using UC Berkeley Macrolab vector 2-BT (Addgene #29666). Truncations and other modified constructs were cloned by PCR mutagenesis and isothermal assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminal HA-tagged full-length pCGN-ATF6-N plasmid came from Addgene (catalog #: 11974, human). The XBP1s plasmid was a kind gift from Dr ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Plant Biology 2020Quote: ... pAG426GAL_eGFP_ccdB (Addgene; N-terminal GFP fusions) or pAG426GAL_ccdB_eGFP (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: The pcDNA3-Shh (N) (Addgene, #37680) was used as template to amplify the cDNA coding residues 24-197 of mouse Shh ...
-
bioRxiv - Cell Biology 2019Quote: ... mVenus-VE-Cadherin-N-10 (Addgene plasmid # 56340 ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-N-10 (Addgene #53979), mEmerald-actin-C-18 (Addgene #53978) ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3-N-Flag-ASC1 (Addgene, #75134) plasmid was used ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The N-terminus fusion plasmid pDN0605 was constructed using pDEST-DHFR F[1,2]-N (TRP1) (Addgene #177797) (Evans-Yamamoto et al ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid #54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid #54560 ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid#54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid#54560 ...
-
bioRxiv - Immunology 2020Quote: Emerald-Dectin1A-N-10(Addgene plasmid, #56291), Emerald-Dectin1A-C-10 (Addgene plasmid # 54057) ...
-
bioRxiv - Microbiology 2022Quote: ... into pDEST-CMV-N-EGFP (#122842, Addgene). pCMV-EGFP-ORF3a-Q57E-S58L-Q116L was constructed as described(Yang et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-hsyn-GFP (n=20; Addgene 50465 ...