Labshake search
Citations for Addgene :
1 - 50 of 826 citations for 6 Oxabicyclo 3.1.0 hexane 3 carboxylicacid ethylester 1α 3α 5α 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...
-
bioRxiv - Cancer Biology 2022Quote: ... pcDNA4-myc-PGC-1α (Plasmid #10974) and PGC-1α promoter luciferase delta CRE (Plasmid #8888) were purchased from Addgene. pRL/TK (renilla-luciferase ...
-
bioRxiv - Genomics 2023Quote: ... and flanking regions of respective ER localized proteins were inserted into a backbone containing a UCOE-EF-1α promoter and a 3′ WPRE element (Addgene #135448) (Jost et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... The HIF-1α construct was obtained from Addgene (Watertown, MA). Glucose uptake assay was performed with Glucose Uptake Cell-based Assay Kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Molecular Biology 2021Quote: ... and HA– HIF-1α was a gift from William Kaelin (Addgene plasmid 18955 ...
-
bioRxiv - Biochemistry 2023Quote: ... or PGC-1α 2kb promoter (Handschin et al. 2003) (Addgene #8887), normalization plasmid coding for Renilla luciferase (pRL-SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Physiology 2019Quote: ... as were plasmids for recombinant production of PGC-1α (Addgene #1028 and 1029) (Puigserver et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were transfected with 0.5 μg of EGFP-PGC-1α FL (Addgene, #4) or ΔCTD for 24 h.
-
bioRxiv - Molecular Biology 2021Quote: ... and HA– HIF-1α was a gift from William Kaelin (Addgene plasmid 18955, RRID:Addgene_18955 [http://n2t.net/addgene:18955] ...
-
bioRxiv - Immunology 2022Quote: ... The amplified TCR genes were sub-cloned into the pEF- 1α/pENTR vector (Addgene) and sequenced.
-
bioRxiv - Molecular Biology 2020Quote: ... mouse PGC-1α FL and ΔCTD were PCR-amplified from the pcDNA-f:PGC1 (Addgene, # 1026) and pcDNA-f:PGC1(delta CTD ...
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Physiology 2023Quote: ... was replaced by the EF-1α promoter from the plasmid pEF.myc.ER-E2-Crimson (Gift from Dr Benjamin Glick; Addgene plasmid # 38770 ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Cell Biology 2022Quote: ... IA) into a lentiviral pU6-sgRNA EF-1α-Puro-T2A-BFP vector digested with BstXI/BlpI (Addgene, cat# 84832). BFP was excised in certain sgRNA variants when the color interfered ...
-
bioRxiv - Biochemistry 2020Quote: ... HA-HIF-1α was linearized with BamHI and had the clover gene amplified from the pcDNA3-Clover plasmid (Addgene #40259). To generate HA-Clover ...
-
bioRxiv - Cell Biology 2020Quote: ... Green fluorescent protein-tagged HIF-1α DM(P402/564A) was generated by inserting the sequence of Clover (Addgene plasmid #40259) behind the myc-tag in the BamHI-digested pCMV-Myc-HIF-1α DM(PP/AA ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of the human HIF-1α gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation ...
-
bioRxiv - Cell Biology 2023Quote: ... see table S8) into a lentiviral pU6-sgRNA EF-1α-Puro-T2A-BFP vector digested with BstXI/BlpI (Addgene, #84832). The exception was the sgRNAs for TTC1 and Control used in the Seahorse assay ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Neuroscience 2022Quote: ... The pLenti-U6-(BsmBI)-hSyn-SaCas9-P2A-EGFP vector allowing the expression of Staphylococcus aureus Cas9 and a guide RNA for the knockdown of AP4 β and AP4 ε were constructed by replacing the EF-1α promoter in the pLenti_SaCRISPR-EGFP plasmid (gift from Christopher Vakoc; Addgene 118636) with the hSyn promoter from the pAAV-hSyn-EGFP plasmid (gift from Bryan Roth ...
-
bioRxiv - Cancer Biology 2023Quote: ... the EF-1α core promoter and the tetracycline repressor (TetR) into the KpnI and BamHI sites of lentiCRISPR-v2 (Addgene, 52961). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... The cagA fragment was digested with KpnI and EagI and subcloned into the lentivirus entry vector pEF-1α/pENTR (Addgene, #17427) containing the EF promoter ...
-
bioRxiv - Neuroscience 2022Quote: ... the NheI – BsrGI fragment containing SFL in the pcDNA3.1/CAG vector was ligated into the corresponding RE sites of an AAV2 vector with the elongation factor 1α promoter and double-floxed inverted open reading frame (EF1a-DIO; a gift from Karl Deisseroth; Addgene plasmid #: 55631; RRID: Addgene_55631) in the untranslatable reverse orientation ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Microbiology 2021Quote: ... 2017 #6} (Addgene, Cat#1000000115), and verified by PCR ...
-
bioRxiv - Physiology 2023Quote: ... 6 μg of psPAX2 (Addgene), and 15 μg of pLV6-BMAL1-Luc vector (Addgene) ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequence for L7-6 was obtained from pAAV/L7-6-GFP-WPRE (Addgene plasmid #126462) and ordered as a gBLOCK (IDT) ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319 ...
-
bioRxiv - Developmental Biology 2021Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 μg of psPAX2 (12260; Addgene), and 3 μg of pVSVg (8454 ...
-
bioRxiv - Microbiology 2022Quote: ... 6 µg PMD2.G (Addgene, 12259), 18µg PsPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 μg, Addgene plasmid # 12260) and pAdVAntage (3 μg ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg pMD2.G (Addgene, 12259), 4 μg pUMVC (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G (Addgene, 12259, 6 µg) using calcium phosphate precipitation (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 μg pSAD-∆G-F3 (Addgene, 32634) with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene ...
-
bioRxiv - Pathology 2021Quote: ... and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5 ...