Labshake search
Citations for Addgene :
1 - 50 of 650 citations for 6 Isoquinolinamine 5 propyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Microbiology 2021Quote: ... 2017 #6} (Addgene, Cat#1000000115), and verified by PCR ...
-
bioRxiv - Physiology 2023Quote: ... 6 μg of psPAX2 (Addgene), and 15 μg of pLV6-BMAL1-Luc vector (Addgene) ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequence for L7-6 was obtained from pAAV/L7-6-GFP-WPRE (Addgene plasmid #126462) and ordered as a gBLOCK (IDT) ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319 ...
-
bioRxiv - Developmental Biology 2021Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 μg of psPAX2 (12260; Addgene), and 3 μg of pVSVg (8454 ...
-
bioRxiv - Microbiology 2022Quote: ... 6 µg PMD2.G (Addgene, 12259), 18µg PsPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 μg, Addgene plasmid # 12260) and pAdVAntage (3 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg pMD2.G (Addgene, 12259), 4 μg pUMVC (Addgene ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G (Addgene, 12259, 6 µg) using calcium phosphate precipitation (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 μg pSAD-∆G-F3 (Addgene, 32634) with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene ...
-
bioRxiv - Pathology 2021Quote: ... and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5 ...
-
bioRxiv - Cell Biology 2020Quote: ... and envelope (6 μg pMD2.G, Addgene #12259) viral plasmids were diluted in 500 μL serum-free DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 μg of psPAX2 (Addgene, Cat #12260) into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg of psPAX2 packaging plasmid (Addgene plasmid #12260), and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then were inserted into pBP-Gal80Uw-6 (#26236, Addgene) via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120 ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450 ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 μg of psPAX2 packaging plasmid (plasmid #12260; Addgene, Teddington, UK), 2 μg pMD2.G envelope plasmid (plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453 ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Cell Biology 2020Quote: ... YFP-Parkin was a gift from Richard Youle (Addgene plasmid #23955)6 and EGFP-LC3 was a gift from Karla Kirkegaard (Addgene plasmid #11546)7 ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.