Labshake search
Citations for Addgene :
1 - 50 of 1869 citations for 6 Ethyl N N dimethyl 1H pyrrolo 2 3 b pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The full-length RUVBL1 with N-terminal 3×FLAG tag (pCDNA-3xFLAG-Pontin) was obtained from Addgene (51635). All cell lines were grown in DMEM (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... N (Addgene # 64087), P (Addgene # 64088) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse: 5’-AAAC-(N)19-20-3’) were designed and cloned in a zebrafish U6 promoter-driven vector (Addgene#64245) at BsmBI restriction sites according to the previous study (Jao et al. ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Bioengineering 2021Quote: ... the sequence encoding the PE2 N terminus (PE2-N term) (Addgene #132775) and a splicing donor (SD ...
-
bioRxiv - Cancer Biology 2021Quote: ... N-Myc (Addgene #74163) was cloned into plasmid pcDNA5/FRT/TO (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Molecular Biology 2021Quote: ... N-terminal FKBP12F36V fragments were originally amplified originally from pLEX_305-N-dTAG (Addgene #91797) (Nabet et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3-N-HA-NEK7 and pcDNA3-N-HA-NEK7K64M were gifts from Bruce Beutler (Addgene plasmid # 75142 ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminal HA-tagged full-length pCGN-ATF6-N plasmid came from Addgene (catalog #: 11974, human). The XBP1s plasmid was a kind gift from Dr ...
-
bioRxiv - Plant Biology 2020Quote: ... pAG426GAL_eGFP_ccdB (Addgene; N-terminal GFP fusions) or pAG426GAL_ccdB_eGFP (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: The pcDNA3-Shh (N) (Addgene, #37680) was used as template to amplify the cDNA coding residues 24-197 of mouse Shh ...
-
bioRxiv - Cell Biology 2019Quote: ... mVenus-VE-Cadherin-N-10 (Addgene plasmid # 56340 ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-N-10 (Addgene #53979), mEmerald-actin-C-18 (Addgene #53978) ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3-N-Flag-ASC1 (Addgene, #75134) plasmid was used ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The N-terminus fusion plasmid pDN0605 was constructed using pDEST-DHFR F[1,2]-N (TRP1) (Addgene #177797) (Evans-Yamamoto et al ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Molecular Biology 2021Quote: ... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid #54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid #54560 ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid#54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid#54560 ...
-
bioRxiv - Immunology 2020Quote: Emerald-Dectin1A-N-10(Addgene plasmid, #56291), Emerald-Dectin1A-C-10 (Addgene plasmid # 54057) ...
-
bioRxiv - Microbiology 2022Quote: ... into pDEST-CMV-N-EGFP (#122842, Addgene). pCMV-EGFP-ORF3a-Q57E-S58L-Q116L was constructed as described(Yang et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-hsyn-GFP (n=20; Addgene 50465 ...
-
bioRxiv - Molecular Biology 2023Quote: ... TOMM20 (mCherry-TOMM20-N-10 Addgene 55146) and TFAM (pcDNA3-TFAM-mCLOVER Addgene 129574 ...
-
bioRxiv - Neuroscience 2023Quote: ... tdTomato-MAPTau-N-10 (Addgene plasmid #58113) and tdTomato-C1 (Addgene plasmid #54653) ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald-MyosinIIA-N-14 (Addgene plasmid #54191) and mApple-LC-myosin-C-10 (Addgene plasmid #54919 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pLVpuro-CMV-N-mCherry (Addgene, #123221) for lentiviral expression ...
-
bioRxiv - Cell Biology 2024Quote: ... and mCherry-MyosinIIB-N-18 (Addgene #55107) was achieved using a Nucleofector II electroporator and the Cell Line Nucleofector Kit V (Lonza Biosciences) ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2020Quote: ... The AAV5-EF1a-DIO-eYFP (Addgene, n°27056) (3.3 × 10e12 particles/ml) ...
-
bioRxiv - Cell Biology 2019Quote: ... or mEmerald-IFT88-N-18 (Addgene plasmid #54125). Cells were then selected with G418 and sorted based on their fluorescence ...
-
bioRxiv - Immunology 2020Quote: ... and mCherry-Dectin1A-N-10 (Addgene plasmid # 55026) was a gift from Michael Davidson ...
-
bioRxiv - Microbiology 2023Quote: ... and CoV2-N-WT-Hu1 (Addgene plasmid # 177937) plasmids were a gift from Jennifer Doudna [52] ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hsyn-eNpHR3.0-eY-FP (n=12; Addgene 26972 ...
-
bioRxiv - Genetics 2023Quote: ... and pCbh_v5 AAV-CBE N-terminal (Addgene, # 137175). Cloned vectors were validated by Sanger sequencing ...